MAGEB2 (NM_002364) Human Untagged Clone

CAT#: SC122625

MAGEB2 (untagged)-Human melanoma antigen family B, 2 (MAGEB2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MAGEB2
• Synonyms: CT3.2; DAM6; MAGE-XP-2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_002364, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCTCGTGGTCAGAAGAGTAAGCTCCGTGCCCGTGAGAAACGCCGCAAGGCCCGAGATGAGACCCGGG
  GTCTCAATGTTCCTCAGGTCACTGAAGCAGAGGAAGAAGAGGCCCCCTGCTGTTCCTCTTCTGTTTCTGG
  GGGTGCTGCTTCAAGCTCTCCTGCTGCTGGCATTCCCCAGGAGCCTCAGAGAGCCCCAACCACTGCCGCT
  GCTGCGGCTGCGGGTGTTTCATCCACAAAATCTAAAAAAGGTGCCAAGAGCCACCAAGGTGAGAAAAATG
  CAAGTTCCTCCCAGGCCTCAACATCCACTAAGAGCCCAAGCGAAGATCCTCTAACCAGGAAGTCAGGGTC
  GTTGGTGCAGTTCCTGTTGTACAAGTATAAAATAAAAAAGTCCGTTACAAAGGGAGAAATGCTGAAAATT
  GTTGGCAAAAGGTTCAGGGAGCACTTCCCTGAGATCCTCAAGAAAGCCTCTGAGGGCCTCAGTGTTGTCT
  TTGGCCTTGAGCTGAATAAAGTCAACCCCAACGGCCACACTTACACCTTCATCGACAAGGTAGACCTCAC
  TGATGAGGAATCCCTGCTCAGTTCCTGGGACTTTCCCAGGAGAAAGCTTCTGATGCCTCTCCTGGGTGTG
  ATCTTCTTAAATGGCAACTCAGCTACTGAGGAAGAGATCTGGGAATTCCTGAATATGTTGGGAGTCTATG
  ATGGAGAGGAGCACTCAGTCTTTGGGGAACCCTGGAAGCTCATCACCAAAGATCTGGTGCAGGAAAAATA
  TCTGGAGTACAAGCAGGTGCCCAGCAGTGATCCCCCACGCTTTCAATTCCTGTGGGGTCCGAGAGCCTAT
  GCTGAAACCAGCAAGATGAAAGTCCTGGAGTTTTTGGCCAAGGTAAATGGTACCACCCCCTGTGCCTTCC
  CAACCCATTACGAAGAAGCTTTGAAAGATGAAGAGAAAGCCGGAGTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_002364
• Insert Size: 1631 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002364.4, NP_002355.2
• RefSeq Size: 1628 bp
• RefSeq ORF: 960 bp
• Locus ID: 4113
• Cytogenetics: Xp21.2
• Gene Summary: 'This gene is a member of the MAGEB gene family. The members of this family have their entire coding sequences located in the last exon, and the encoded proteins show 50 to 68% sequence identity to each other. The promoters and first exons of the MAGEB genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. This gene is localized in the DSS (dosage-sensitive sex reversal) critical region. It is expressed in testis and placenta, and in a significant fraction of tumors of various histological types. The MAGEB genes are clustered on chromosome Xp22-p21. [provided by RefSeq, Jul 2008]'