KCNJ1 (NM_000220) Human Untagged Clone

CAT#: SC123920

KCNJ1 (untagged)-Human potassium inwardly-rectifying channel, subfamily J, member 1 (KCNJ1), transcript variant rom-k1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KCNJ1
• Synonyms: KIR1.1; ROMK; ROMK1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_000220, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAATGCTTCCAGTCGGAATGTGTTTGACACGTTGATCAGGGTGTTGACAGAAAGTATGTTCAAACATC
  TTCGGAAATGGGTCGTCACTCGCTTTTTTGGGCATTCTCGGCAAAGAGCAAGGCTAGTCTCCAAAGATGG
  AAGGTGCAACATAGAATTTGGCAATGTGGAGGCACAGTCAAGGTTTATATTCTTTGTGGACATCTGGACA
  ACGGTACTTGACCTCAAGTGGAGATACAAAATGACCATTTTCATCACAGCCTTCTTGGGGAGTTGGTTTT
  TCTTTGGTCTCCTGTGGTATGCAGTAGCGTACATTCACAAAGACCTCCCGGAATTCCATCCTTCTGCCAA
  TCACACTCCCTGTGTGGAGAATATTAATGGCTTGACCTCAGCTTTTCTGTTTTCTCTGGAGACTCAAGTG
  ACCATTGGATATGGATTCAGGTGTGTGACAGAACAGTGTGCCACTGCCATTTTTCTGCTTATCTTTCAGT
  CTATACTTGGAGTTATAATCAATTCTTTCATGTGTGGGGCCATCTTAGCCAAGATCTCCAGGCCCAAAAA
  ACGTGCCAAGACCATTACGTTCAGCAAGAACGCAGTGATCAGCAAACGGGGAGGGAAGCTTTGCCTCCTA
  ATCCGAGTGGCTAATCTCAGGAAGAGCCTTCTTATTGGCAGTCACATTTATGGAAAGCTTCTGAAGACCA
  CAGTCACTCCTGAAGGAGAGACCATTATTTTGGACCAGATCAATATCAACTTTGTAGTTGACGCTGGGAA
  TGAAAATTTATTCTTCATCTCCCCATTGACAATTTACCATGTCATTGATCACAACAGCCCTTTCTTCCAC
  ATGGCAGCGGAGACCCTTCTCCAGCAGGACTTTGAATTAGTGGTGTTTTTAGATGGCACAGTGGAGTCCA
  CCAGTGCTACCTGCCAAGTCCGGACATCCTATGTCCCAGAGGAGGTGCTTTGGGGCTACCGTTTTGCTCC
  CATAGTATCCAAGACAAAGGAAGGGAAATACCGAGTGGATTTCCATAACTTTAGCAAGACAGTGGAAGTG
  GAGACCCCTCACTGTGCCATGTGCCTTTATAATGAGAAAGATGTTAGAGCCAGGATGAAGAGAGGCTATG
  ACAACCCCAACTTCATCTTGTCAGAAGTCAATGAAACAGATGACACCAAAATGTAA
  
  
• Restriction Sites: Please inquire
• ACCN: NM_000220
• Insert Size: 2200 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_000220.2, NP_000211.1
• RefSeq Size: 2332 bp
• RefSeq ORF: 1176 bp
• Locus ID: 3758
• Cytogenetics: 11q24.3
• Protein Families: Druggable Genome, Ion Channels: Potassium, Transmembrane
• Gene Summary: 'Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. It is activated by internal ATP and probably plays an important role in potassium homeostasis. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Mutations in this gene have been associated with antenatal Bartter syndrome, which is characterized by salt wasting, hypokalemic alkalosis, hypercalciuria, and low blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (1, also known as rom-k1) encodes the longest isoform (a).