CACNG6 (NM_145814) Human Untagged Clone

CAT#: SC124006

CACNG6 (untagged)-Human calcium channel, voltage-dependent, gamma subunit 6 (CACNG6), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CACNG6
• Synonyms: 2310033H20Rik; AW050150; calcium channel, voltage-dependent, gamma subunit 6; MGC144251; MGC144252; voltage-dependent calcium channel gamma-6 subunit
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_145814 edited
  TCGCCACCATGATGTGGTCCAACTTCTTCCTGCAAGAGGAGAACCGGCGGCGGGGGGCCG
  CGGGCCGGCGGCGGGCGCACGGGCAGGGCAGGTCGGGGCTGACGCCCGAGCGCGAGGGGA
  AGGTGAAGCTGGCGCTGCTGCTGGCCGCCGTGGGCGCCACGCTGGCGGTGCTGTCCGTGG
  GCACCGAGTTCTGGGTGGAGCTCAACACCTACAAGGCCAACGGCAGCGCCGTGTGCGAAG
  CGGCCCACCTGGGGCTGTGGAAGGCGTGCACCAAGCGGCTGTGGCAGGCGGACGTGCCCG
  TGGACAGGGACACCTGCGGCCCCGCGGAGCTGCCCGGAGAAGCAAACTGCACCTATTTTA
  AATTCTTCACCACGGGGGAGAATGCACGCATCTTTCAGAGAACCACAAAGAAAGAGGTGA
  ATCTGGCAGCTGCGGTGATAGCAGTGCTGGGCCTGGCAGTCATGGCCTTGGGGTGCCTCT
  GTATCATCATGGTGCTCAGTAAAGGTGCAGAGTTCCTGCTCCGAGTTGGAGCCGTCTGCT
  TTGGCCTCTCAGGCCTGCTGCTCTTGGTGAGCCTGGAGGTGTTCCGGCATTCCGTGAGGG
  CCCTGCTGCAGAGAGTCAGCCCGGAGCCTCCCCCGGCCCCACGCCTCACCTACGAGTACT
  CCTGGTCCCTGGGCTGCGGCGTGGGGGCCGGCCTGATCCTGCTGTTGGGGGCCGGCTGCT
  TTCTGCTGCTCACACTGCCTTCCTGGCCCTGGGGGTCCCTCTGTCCCAAGCGGGGGCACC
  GGGCCACCTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_145814
• ORF Size: 783 bp
• Insert Size: 800
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_145814.1, NP_665813.1
• RefSeq Size: 1886
• RefSeq ORF: 783
• Locus ID: 59285
• Protein Families: Druggable Genome, Ion Channels: Other, Transmembrane
• Protein Pathways: Arrhythmogenic right ventricular cardiomyopathy (ARVC), Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), MAPK signaling pathway
• Gene Summary: Voltage-dependent calcium channels are composed of five subunits. The protein encoded by this gene represents one of these subunits, gamma, and is one of two known gamma subunit proteins. This particular gamma subunit is an integral membrane protein that is thought to stabilize the calcium channel in an inactive (closed) state. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members that function as transmembrane AMPA receptor regulatory proteins (TARPs). Alternative splicing results in multiple transcript variants. Variants in this gene have been associated with aspirin-intolerant asthma. [provided by RefSeq, Dec 2010]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a).