SPINK1 (NM_003122) Human Untagged Clone

CAT#: SC125664

SPINK1 (untagged)-Human serine peptidase inhibitor, Kazal type 1 (SPINK1)


  "NM_003122" in other vectors (6)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "SPINK1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SPINK1
Synonyms PCTT; PSTI; Spink3; TATI; TCP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_003122 edited
CGCAGAACTTCAGCCATGAAGGTAACAGGCATCTTTCTTCTCAGTGCCTTGGCCCTGTTG
AGTCTATCTGGTAACACTGGAGCTGACTCCCTGGGAAGAGAGGCCAAATGTTACAATGAA
CTTAATGGATGCACCAAGATATATGACCCTGTCTGTGGGACTGATGGAAATACTTATCCC
AATGAATGCGTGTTATGTTTTGAAAATCGGAAACGCCAGACTTCTATCCTCATTCAAAAA
TCTGGGCCTTGCTGAGAACCAAGGTTTTGAAATCCCATCAGGTCACCGCGAGGCCTGACT
GGCCTTATTGTTGAATAAATGTATCTGAATATCAAAAAAAAAAAAAAAAAAAAAAAAAAA
AA
>OriGene 5' read for NM_003122 unedited
TCTGATTTGTATACGACTCACTATAGGCGGCCGCGTATTCAGATCTGGTACCGGCTCCGT
AATTCCCGGGATCGCAGAACTTCAGCCATGAAGGTAACAGGCATCTTTCTTCTCAGTGCC
TTGGCCCTGTTGAGTCTATCTGGTAACACTGGAGCTGACTCCCTGGGAAGAGAGGCCAAA
TGTTACAATGAACTTAATGGATGCACCAAGATATATGACCCTGTCTGTGGGACTGATGGA
AATACTTATCCCAATGAATGCGTGTTATGTTTTGAAAATCGGAAACGCCAGACTTCTATC
CTCATTCAAAAATCTGGGCCTTGCTGAGAACCAAGGTTTTGAAATCCCATCAGGTCACCG
CGAGGCCTGACTGGCCTTATTGTTGAATAAATGTATCTGAATATCNNANAAAAAAAAAAA
AAAAAAAAAAAAAGGGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCAT
CCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACC
AGCCTTGTCCTAATAAAATTAAATTGCATCATTTTGTCTGACTAGGTGTCCTTCTATATA
TTATGGGGTGGAGGGGGGTGGTATTGAGCAAGGGGGCAAGTTGGGAAAACAACCCTGTAG
GCCTGGGGGGTCTATTGGGACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAA
TCCTCCCCTCTGGGGTCAAGCGATTTTCCTGGCCTAACCTCCCGAGTTGTTGGGATTCCC
AGCCTGCATGACCAGGCTAAATATATTTTGTTTTTTTGTAAAAACGGGGTTCCCCTTTTG
CCAGGGGGGGTCCAACCCTAAACCGGGAGTCACCCCCCTTGGCCCCCAATTGGGGGTAAC
AGGGGGAACAAGGGCCTTCCGGGCCTCTTTATAAAA
Restriction Sites NotI-NotI     
ACCN NM_003122
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003122.2, NP_003113.2
RefSeq Size 438 bp
RefSeq ORF 240 bp
Locus ID 6690
Cytogenetics 5q32
Protein Families Druggable Genome, Secreted Protein
Gene Summary 'The protein encoded by this gene is a trypsin inhibitor, which is secreted from pancreatic acinar cells into pancreatic juice. It is thought to function in the prevention of trypsin-catalyzed premature activation of zymogens within the pancreas and the pancreatic duct. Mutations in this gene are associated with hereditary pancreatitis and tropical calcific pancreatitis. [provided by RefSeq, Oct 2008]'
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.