Placental lactogen (CSH2) (NM_022644) Human Untagged Clone

CAT#: SC127020

CSH2 (untagged)-Human chorionic somatomammotropin hormone 2 (CSH2), transcript variant 2


  "NM_022644" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CSH2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CSH2
Synonyms CS-2; CSB; GHB1; hCS-B; PL
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_022644, the custom clone sequence may differ by one or more nucleotides


ATGGCTGCAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGCCCTGCTCTGCCTGCCCTGGCTTCAAGAGG
CTGGTGCCGTCCAAACCGTTCCGTTATCCAGGCTTTTTGACCACGCTATGCTCCAAGCCCATCGCGCGCA
CCAGCTGGCCATTGACACCTACCAGGAGTTTGAAGAAACCTATATCCCAAAGGACCAGAAGTATTCATTC
CTGCATGACTCCCAGACCTCCTTCTGCTTCTCAGACTCTATTCCGACACCCTCCAACATGGAGGAAACGC
AACAGAAATCCAATCTAGAGCTGCTCCGCATCTCCCTGCTGCTCATCGAGTCGTGGCTGGAGCCCGTGCG
GTTCCTCAGGAGTATGTTCGCCAACAACCTGGTGTATGACACCTCGGACAGCGATGACTATCACCTCCTA
AAGGACCTAGAGGAAGGCATCCAAACGCTGATGGGGGTGAGGGTGGCGCCAGGGGTCGCCAATCCTGGAA
CCCCACTGGCTTAG


>OriGene 5' read for NM_022644 unedited
CCCCGGGCCCCCNNNNNNNNNTNNNCCCNCCCCCGCCCGTCAAATTGTAACGACCACTAA
GGCGGCCGGAATCGCCGACCCGACCACTCAGGTCCTGTGGACAGCTCACCTAGTGGCAAT
GGCTCCAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGCCCTGCTCTGCCTGCCCTGGCT
TCAAGAGGCTGGTGCCGTCCAAACCGTTCCGTTATCCAGGCTTTTTGACCACGCTATGCT
CCAAGCCCATCGCGCGCACCAGCTGGCCATTGACACCTACCAGGAGTTTGAAGAAACCTA
TATCCCAAAGGACCAGAAGTATTCATTCCTGCATGACTCCCAGACCTCCTTCTGCTTCTC
AGACTCTATTCCGACACCCTCCAACATGGAGGAAACGCAACAGAAATCCAATCTAGAGCT
GCTCCGCATCTCCCTGCTGCTCATCGAGTCGTGGCTGGAGCCCGTGCGGTTCCTCAGGAG
TATGTTCGCCAACAACCTGGTGTATGACACCTCGGACAGCGATGACTATCACCTCCTAAA
GGACCTAGAGGAAGGCATCCAAACGCTGATGGGGGTGAGGGTGGCGCCAGGGGTCACCAA
TCCTGGAACCCCACTGGCTTCGAGGGCTGGGGGAGAAGAATACTGCTGCCCTCTTTNTAG
CAGTAAGGCGCTGACCCAAGAGAACTCACCTTATTCTTCATTTCGCCTGGTGAATCCTNC
AGGCCTTTCTCTACACCCTGAAGGGAGGGANGAAAATGATAAAATGAGAGAAGGAGGGAA
CAGTGCCCAAGCGCTTGGCCTCTCCTTCTCTTCCCTCACTTTGCAAAGGCTGGAAAACGG
CAGCCCGCNGNACTGGGCAGATNCCTCAGCAGACCTACAGCCAGTTTTGCCACAAACTCG
CACAACCATGACGCACTGCTCAAAGACTACGGGCTGCTCTACTGCTTCAGAAAGGACATG
GACCAAGTCNAGAAAATTCTGG
Restriction Sites NotI-NotI     
ACCN NM_022644
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_022644.2, NP_072170.1
RefSeq Size 1134 bp
RefSeq ORF 504 bp
Locus ID 1443
Cytogenetics 17q23.3
Protein Families Secreted Protein
Gene Summary 'The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, while the ratio of 1 to 2 increases by term. Structural and expression differences provide avenues for developmental regulation and tissue specificity. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2) contains intron D and encodes an isoform (2) that diverges from all other CS isoforms in the carboxy-terminus due to a frameshift. Early truncation occurs relative to a similarly spliced variant of chorionic somatomammotropin hormone 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.