PAX2 (NM_000278) Human Untagged Clone

CAT#: SC300041

PAX2 (untagged)-Human paired box 2 (PAX2), transcript variant b

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PAX2
• Synonyms: FSGS7; PAPRS
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF within SC300041 sequence for NM_000278 edited (data generated by NextGen Sequencing)
  ATGGATATGCACTGCAAAGCAGACCCCTTCTCCGCGATGCACCNNNGGCACGGGGGTGTG
  AACCAGCTCGGGGGGGTGTTTGTGAACGGCCGGCCCCTACCCGACGTGGTGAGGCAGCGC
  ATCGTGGAGCTGGCCCACCAGGGTGTGCGGCCCTGTGACATCTCCCGGCAGCTGCGGGTC
  AGCCACGGCTGTGTCAGCAAAATCCTGGGCAGGTACTACGAGACCGGCAGCATCAAGCCG
  GGTGTGATCGGTGGCTCCAAGCCCAAAGTGGCGACGCCCAAAGTGGTGGACAAGATTGCT
  GAATACAAACGACAGAACCCGACTATGTTCGCCTGGGAGATTCGAGACCGGCTCCTGGCC
  GAGGGCATCTGTGACAATGACACAGTGCCCAGCGTCTCTTCCATCAACAGAATCATCCGG
  ACCAAAGTTCAGCAGCCTTTCCACCCAACGCCGGATGGGGCTGGGACAGGAGTGACCGCC
  CCTGGCCACACCATTGTTCCCAGCACGGCCTCCCCTCCTGTTTCCAGCGCCTCCAATGAC
  CCAGTGGGATCCTACTCCATCAATGGGATCCTGGGGATTCCTCGCTCCAATGGTGAGAAG
  AGGAAACGTGATGAAGATGTGTCTGAGGGCTCAGTCCCCAATGGAGATTCCCAGAGTGGT
  GTGGACAGTTTGCGGAAGCACTTGCGAGCTGACACCTTCACCCAGCAGCAGCTGGAAGCT
  TTGGATCGGGTCTTTGAGCGTCCTTCCTACCCTGACGTCTTCCAGGCATCAGAGCACATC
  AAATCAGAACAGGGGAACGAGTACTCCCTCCCAGCCCTGACCCCTGGGCTTGATGAAGTC
  AAGTCGAGTCTATCTGCATCCACCAACCCTGAGCTGGGCAGCAACGTGTCAGGCACACAG
  ACATACCCAGTTGTGACTGGTCGTGACATGGCGAGCACCACTCTGCCTGGTTACCCCCCT
  CACGTGCCCCCCACTGGCCAGGGAAGCTACCCCACCTCCACCCTGGCAGGAATGGTGCCT
  GGGAGCGAGTTCTCCGGCAACCCGTACAGCCACCCCCAGTACACGGCCTACAACGAGGCT
  TGGAGATTCAGCAACCCCGCCTTACTAAGTTCCCCTTATTATTATAGTGCCGCCCCCCGG
  TCCGCCCCTGCCGCTGCTGCCGCTGCCTATGACCGCCACTAG
  
  Clone variation with respect to NM_000278.3
  44 c=>n;45 a=>n;46 g=>n
• Restriction Sites: Please inquire
• ACCN: NM_000278
• Insert Size: 1300 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to differ from the protein associated to this reference by three amino acids.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_000278.2, NP_000269.2
• RefSeq Size: 4207 bp
• RefSeq ORF: 1182 bp
• Locus ID: 5076
• Cytogenetics: 10q24.31
• Protein Families: Druggable Genome
• Gene Summary: 'PAX2 encodes paired box gene 2, one of many human homologues of the Drosophila melanogaster gene prd. The central feature of this transcription factor gene family is the conserved DNA-binding paired box domain. PAX2 is believed to be a target of transcriptional supression by the tumor suppressor gene WT1. Mutations within PAX2 have been shown to result in optic nerve colobomas and renal hypoplasia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]'
  Transcript Variant: This variant (b) lacks an alternate in-frame exon and uses an alternate splice site in the 3' coding region, compared to variant e. This results in a protein (isoform b) with a shorter, distinct C-terminus compared to isoform e. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to add an additional glycine residue in the protein C-terminal region, supported by the available transcript and conservation data.