OPN1MW (NM_000513) Human Untagged Clone

CAT#: SC300086

OPN1MW (untagged)-Human opsin 1 (cone pigments), medium-wave-sensitive (OPN1MW)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OPN1MW
• Synonyms: CBBM; CBD; COD5; GCP; GOP; OPN1MW1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_000513, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGCAGGACAGCTATGAGGACAGCACCC
  AGTCCAGCATCTTCACCTACACCAACAGCAACTCCACCAGAGGCCCCTTCGAAGGCCCGAATTACCACAT
  CGCTCCCAGATGGGTGTACCACCTCACCAGTGTCTGGATGATCTTTGTGGTCATTGCATCCGTCTTCACA
  AATGGGCTTGTGCTGGCGGCCACCATGAAGTTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTGA
  ACCTGGCGGTCGCTGACCTGGCAGAGACCGTCATCGCCAGCACTATCAGCGTTGTGAACCAGGTCTATGG
  CTACTTCGTGCTGGGCCACCCTATGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATCACAGGT
  CTCTGGTCTCTGGCCATCATTTCCTGGGAGAGATGGATGGTGGTCTGCAAGCCCTTTGGCAATGTGAGAT
  TTGATGCCAAGCTGGCCATCGTGGGCATTGCCTTCTCCTGGATCTGGGCTGCTGTGTGGACAGCCCCGCC
  CATCTTTGGTTGGAGCAGGTACTGGCCCCACGGCCTGAAGACTTCATGCGGCCCAGACGTGTTCAGCGGC
  AGCTCGTACCCCGGGGTGCAGTCTTACATGATTGTCCTCATGGTCACCTGCTGCATCACCCCACTCAGCA
  TCATCGTGCTCTGCTACCTCCAAGTGTGGCTGGCCATCCGAGCGGTGGCAAAGCAGCAGAAAGAGTCTGA
  ATCCACCCAGAAGGCAGAGAAGGAAGTGACGCGCATGGTGGTGGTGATGGTCCTGGCATTCTGCTTCTGC
  TGGGGACCATACGCCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGGCTACCCCTTCCACCCTTTGATGG
  CTGCCCTGCCGGCCTTCTTTGCCAAAAGTGCCACTATCTACAACCCCGTTATCTATGTCTTTATGAACCG
  GCAGTTTCGAAACTGCATCTTGCAGCTTTTCGGGAAGAAGGTTGACGATGGCTCTGAACTCTCCAGCGCC
  TCCAAAACGGAGGTCTCATCTGTGTCCTCGGTATCGCCTGCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_000513
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_000513.2, NP_000504.1
• RefSeq Size: 1998 bp
• RefSeq ORF: 1095 bp
• Locus ID: 2652
• Cytogenetics: Xq28
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: 'This gene encodes for a light absorbing visual pigment of the opsin gene family. The encoded protein is called green cone photopigment or medium-wavelength sensitive opsin. Opsins are G-protein coupled receptors with seven transmembrane domains, an N-terminal extracellular domain, and a C-terminal cytoplasmic domain. The long-wavelength opsin gene and multiple copies of the medium-wavelength opsin gene are tandemly arrayed on the X chromosome and frequent unequal recombination and gene conversion may occur between these sequences. X chromosomes may have fusions of the medium- and long-wavelength opsin genes or may have more than one copy of these genes. Defects in this gene are the cause of deutanopic colorblindness. [provided by RefSeq, Mar 2009]'