beta 1 Sodium Potassium ATPase (ATP1B1) (NM_001001787) Human Untagged Clone

CAT#: SC300306

ATP1B1 (untagged)-Human ATPase, Na+/K+ transporting, beta 1 polypeptide (ATP1B1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATP1B1
• Synonyms: ATP1B; MGC1798
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001001787 edited
  CAGCGGCAGCGGCGCGTCCTGCCTGCAGAGAGCCAGGCCGGAGAAGCCGAGCGGCGCAGA
  GGACGCCAGGGCGCGCGCCGCAGCCACCCACCCTCCGGACCGCGGCAGCTGCTGACCCGC
  CATCGCCATGGCCCGCGGGAAAGCCAAGGAGGAGGGCAGCTGGAAGAAATTCATCTGGAA
  CTCAGAGAAGAAGGAGTTTCTGGGCAGGACCGGTGGCAGTTGGTTTAAGATCCTTCTATT
  CTACGTAATATTTTATGGCTGCCTGGCTGGCATCTTCATCGGAACCATCCAAGTGATGCT
  GCTCACCATCAGTGAATTTAAGCCCACATATCAGGACCGAGTGGCCCCGCCAGGATTAAC
  ACAGATTCCTCAGATCCAGAAGACTGAAATTTCCTTTCGTCCTAATGATCCCAAGAGCTA
  TGAGGCATATGTACTGAACATAGTTAGGTTCCTGGAAAAGTACAAAGATTCAGCCCAGAG
  GGATGACATGATTTTTGAAGATTGTGGCGATGTGCCCAGTGAACCGAAAGAACGAGGAGA
  CTTTAATCATGAACGAGGAGAGCGAAAGGTCTGCAGATTCAAGCTTGAATGGCTGGGAAA
  TTGCTCTGGATTAAATGATGAAACTTATGGCTACAAAGAGGGCAAACCGTGCATTATTAT
  AAAGCTCAACCGAGTTCTAGGCTTCAAACCTAAGCCTCCCAAGAATGAGTCCTTGGAGAC
  TTACCCAGTGATGAAGTATAACCCAAATGTCCTTCCCGTTCAGTGCACTGGCAAGCGAGA
  TGAAGATAAGGATAAAGTTGGAAATGTGGAGTATTTTGGACTGGGCAACTCCCCTGGTTT
  TCCTCTGCAGTATTATCCGTACTATGGCAAACTCCTGCAGCCCAAATACCTGCAGCCCCT
  GCTGGCCGTACAGTTCACCAATCTTACCATGGACACTGAAATTCGCATAGAGTGTAAGGC
  GTACGGTGAGAACATTGGGTACAGTGAGAAAGACCGTTTTCAGGGACGTTTTGATGTAAA
  AATTAAATTTTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001001787
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001001787.1, NP_001001787.1
• RefSeq Size: 1568 bp
• RefSeq ORF: 906 bp
• Locus ID: 481
• Cytogenetics: 1q24.2
• Protein Families: Transmembrane
• Protein Pathways: Cardiac muscle contraction
• Gene Summary: 'The protein encoded by this gene belongs to the family of Na+/K+ and H+/K+ ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The beta subunit regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. The glycoprotein subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes a beta 1 subunit. Alternatively spliced transcript variants encoding different isoforms have been described, but their biological validity is not known. [provided by RefSeq, Mar 2010]'
  Transcript Variant: This variant (2) lacks a segment in the coding region, which leads to a frameshift, compared to variant 1. The resulting isoform (b) contains a shorter and distinct C-terminus compared to isoform a.