GMPR2 (NM_001002000) Human Untagged Clone

CAT#: SC300383

GMPR2 (untagged)-Human guanosine monophosphate reductase 2 (GMPR2), transcript variant 2


  "NM_001002000" in other vectors (5)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GMPR2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GMPR2
Synonyms GMPR 2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001002000, the custom clone sequence may differ by one or more nucleotides


ATGCCTCATATTGACAACGATGTGAAACTGGACTTCAAGGATGTCCTTTTGAGGCCCAAACGCAGTACCC
TTAAGTCTCGAAGTGAGGTGGATCTCACAAGATCCTTTTCATTTCGGAACTCAAAGCAGACATACTCTGG
GGTTCCCATCATTGCTGCCAATATGGATACTGTGGGCACCTTTGAGATGGCCAAGGTTCTCTGTAAGTTC
TCTCTCTTCACTGCTGTCCATAAGCACTATAGCCTCGTTCAGTGGCAAGAGTTTGCTGGCCAGAATCCTG
ACTGTCTTGAGCATCTGGCTGCCAGCTCAGGCACAGGCTCTTCTGACTTTGAGCAGCTGGAACAGATCCT
GGAAGCTATTCCCCAGGTGAAGTATATATGCCTGGATGTGGCAAATGGCTACTCTGAACACTTTGTTGAA
TTTGTAAAAGATGTACGGAAGCGCTTCCCCCAGCACACCATCATGGCAGGGAATGTGGTAACAGGAGAGA
TGGTAGAAGAGCTCATCCTTTCTGGGGCTGACATCATCAAAGTGGGAATTGGGCCAGGCTCTGTGTGTAC
TACTCGGAAGAAAACTGGAGTGGGGTATCCACAGCTCAGCGCAGTGATGGAGTGTGCAGATGCTGCTCAT
GGCCTCAAAGGCCACATCATTTCAGATGGAGGTTGCAGCTGTCCTGGGGATGTGGCCAAGGCTTTTGGGG
CAGGAGCTGACTTCGTGATGCTGGGTGGCATGCTGGCTGGGCACAGTGAGTCAGGTGGTGAGCTCATCGA
GAGGGATGGCAAGAAGTACAAGCTCTTCTATGGAATGAGTTCTGAAATGGCCATGAAGAAGTATGCTGGG
GGCGTGGCTGAGTACAGAGCCTCAGAGGGAAAGACAGTGGAAGTTCCTTTTAAAGGAGATGTGGAACATA
CCATCCGAGACATCCTAGGAGGGATCCGCTCTACGTGTACCTATGTGGGAGCAGCTAAGCTCAAAGAGTT
GAGCAGGAGAACTACCTTCATCCGAGTCACCCAGCAGGTGAATCCAATCTTCAGTGAGGCGTGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001002000
ORF Size 1047 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001002000.2, NP_001002000.1
RefSeq Size 1989
RefSeq ORF 1047
Locus ID 51292
Protein Families Druggable Genome
Protein Pathways Purine metabolism
Gene Summary This gene encodes an enzyme that catalyzes the irreversible and NADPH-dependent reductive deamination of guanosine monophosphate (GMP) to inosine monophosphate (IMP). The protein also functions in the re-utilization of free intracellular bases and purine nucleosides. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2017]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1. Variants 2, 3, and 4 encode the same isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.