FMO3 (NM_001002294) Human Untagged Clone

CAT#: SC300436

FMO3 (untagged)-Human flavin containing monooxygenase 3 (FMO3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FMO3
• Synonyms: dJ127D3.1; FMOII; TMAU
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001002294, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGAAGAAAGTGGCCATCATTGGAGCTGGTGTGAGTGGCTTGGCCTCCATCAGGAGCTGTCTGGAAG
  AGGGGCTGGAGCCCACCTGCTTTGAGAAGAGCAATGACATTGGGGGCCTGTGGAAATTTTCAGACCATGC
  AGAGGAGGGCAGGGCTAGCATTTACAAATCAGTCTTTTCCAACTCTTCCAAAGAGATGATGTGTTTCCCA
  GACTTCCCATTTCCCGATGACTTCCCCAACTTTATGCACAACAGCAAGATCCAGGAATATATCATTGCAT
  TTGCCAAAGAAAAGAACCTCCTGAAGTACATACAATTTAAGACATTTGTATCCAGTGTAAATAAACATCC
  TGATTTTGCAACTACTGGCCAGTGGGATGTTACCACTGAAAGGGATGGTAAAAAAGAATCGGCTGTCTTT
  GATGCTGTAATGGTTTGTTCCGGACATCATGTGTATCCCAACCTACCAAAAGAGTCCTTTCCAGGACTAA
  ACCACTTTAAAGGCAAATGCTTCCACAGCAGGGACTATAAAGAACCAGGTGTATTCAATGGAAAGCGTGT
  CCTGGTGGTTGGCCTGGGGAATTCGGGCTGTGATATTGCCACAGAACTCAGCCGCACAGCAGAACAGGTC
  ATGATCAGTTCCAGAAGTGGCTCCTGGGTGATGAGCCGGGTCTGGGACAATGGTTATCCTTGGGACATGC
  TGCTCGTCACTCGATTTGGAACCTTCCTCAAGAACAATTTACCGACAGCCATCTCTGACTGGTTGTACGT
  GAAGCAGATGAATGCAAGATTCAAGCATGAAAACTATGGCTTGATGCCTTTAAATGGAGTCCTGAGGAAA
  GAGCCTGTATTTAACGATGAGCTCCCAGCAAGCATTCTGTGTGGCATTGTGTCCGTAAAGCCTAACGTGA
  AGGAATTCACAGAGACCTCGGCCATTTTTGAGGATGGGACCATATTTGAGGGCATTGACTGTGTAATCTT
  TGCAACAGGGTATAGTTTTGCCTACCCCTTCCTTGATGAGTCTATCATCAAAAGCAGAAACAATGAGATC
  ATTTTATTTAAAGGAGTATTTCCTCCTCTACTTGAGAAGTCAACCATAGCAGTGATTGGCTTTGTCCAGT
  CCCTTGGGGCTGCCATTCCCACAGTTGACCTCCAGTCCCGCTGGGCAGCACAAGTAATAAAGGGAACTTG
  TACTTTGCCTTCTATGGAAGACATGATGAATGATATTAATGAGAAAATGGAGAAAAAGCGCAAATGGTTT
  GGCAAAAGCGAGACCATACAGACAGATTACATTGTTTATATGGATGAACTCTCCTCCTTCATTGGGGCAA
  AGCCCAACATCCCATGGCTGTTTCTCACAGATCCCAAATTGGCCATGGAAGTTTATTTTGGCCCTTGTAG
  TCCCTACCAGTTTAGGCTGGTGGGCCCAGGGCAGTGGCCAGGAGCCAGAAATGCCATACTGACCCAGTGG
  GACCGGTCGTTGAAACCCATGCAGACACGAGTGGTCGGGAGACTTCAGAAGCCTTGCTTCTTTTTCCATT
  GGCTGAAGCTCTTTGCAATTCCTATTCTGTTAATCGCTGTTTTCCTTGTGTTGACCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001002294
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001002294.2, NP_001002294.1
• RefSeq Size: 2107 bp
• RefSeq ORF: 1599 bp
• Locus ID: 2328
• Cytogenetics: 1q24.3
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Drug metabolism - cytochrome P450
• Gene Summary: 'Flavin-containing monooxygenases (FMO) are an important class of drug-metabolizing enzymes that catalyze the NADPH-dependent oxygenation of various nitrogen-,sulfur-, and phosphorous-containing xenobiotics such as therapeutic drugs, dietary compounds, pesticides, and other foreign compounds. The human FMO gene family is composed of 5 genes and multiple pseudogenes. FMO members have distinct developmental- and tissue-specific expression patterns. The expression of this FMO3 gene, the major FMO expressed in adult liver, can vary up to 20-fold between individuals. This inter-individual variation in FMO3 expression levels is likely to have significant effects on the rate at which xenobiotics are metabolised and, therefore, is of considerable interest to the pharmaceutical industry. This transmembrane protein localizes to the endoplasmic reticulum of many tissues. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Mutations in this gene cause the disorder trimethylaminuria (TMAu) which is characterized by the accumulation and excretion of unmetabolized trimethylamine and a distinctive body odor. In healthy individuals, trimethylamine is primarily converted to the non odorous trimethylamine N-oxide.[provided by RefSeq, Jan 2016]'
  Transcript Variant: This variant (2) encodes the longest isoform (a). Variants 1 and 2 both encode the same isoform (a).