SP140 (NM_001005176) Human Untagged Clone

CAT#: SC300816

SP140 (untagged)-Human SP140 nuclear body protein (SP140), transcript variant 2


  "NM_001005176" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "SP140"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SP140
Synonyms LYSP100; LYSP100-A; LYSP100-B
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001005176 edited
CTTTGACTGAGCACCGAGGGGCAGTTGGCAGCTTCACCTCAGAGCTGCAGGAAGGAACGG
GGCAGTGAAAATCGAATCGGGTGTGATCCTAGGCCAAGCTCATGGCCCAGCAGGGCCAGC
AGGGGCAGATGGCAAGTGGAGACAGCAATCTCAACTTCAGGATGGTCGCAGAGATCCAGA
ACGTAGAGGGTCAGAACCTGCAGGAGCAGGTTTGCCCTGAGCCCATTTTCAGGTTCTTCA
GAGAAAACAAGGTGGAGATTGCAAGTGCAATAACAAGGCCATTTCCTTTCCTTATGGGCC
TCCGAGACCGCTCCTTCATCTCCGAGCAGATGTATGAACATTTTCAAGAAGCTTTTAGAA
ACCTGGTCCCAGTGACAAGAGTGATGTATTGTGTACTCAGTGAACTGGAGAAGACATTTG
GCTGGTCACATCTGGAAGCATTGTTCAGCAGGATTAACCTGATGGCCTATCCTGATTTAA
ACGAGATTTACAGAAGCTTCCAGAATGAAAATTTATCATCCAGTGCAGTCCTGTGTCAAC
TTGTTTCTCCAAACAAAGACTGGAGAAGTCACGAAGAGAGCCTAGCACATACTGGTACAC
TGAGGAGGAGCTGCATGTGAAAGCTATGAAGACAGAAAAGGGGGTTGGTGGGGGCCTTTC
CGAACCATGTGGTTGAATTGCAGACTGTGGGAGGCAGGGTGTGAGAGCTGACTCTGGAGA
AAGAAGTTGAAGTGGATTCTGGAAGGCTTGACACCCTGTGCTAAGGAATCTGGAGTTTAA
TTTTTGGAAAATAAAGAAGGAATAAAGGGCATTTAAACGGGAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001005176
ORF Size 519 bp
Insert Size 800
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001005176.1.
Reference Data
RefSeq NM_001005176.1, NP_001005176.1
RefSeq Size 853
RefSeq ORF 519
Locus ID 11262
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene encodes a member of the SP100 family of proteins, which are share common domains including an N-terminal homogeneously staining region domain followed by a SP100/autoimmune regulator/NucP41/P75/deformed epidermal autoregulatory factor domain, a plant homeobox zinc finger, and a bromodomain. The encoded protein is interferon-inducible and is expressed at high levels in the nuclei of leukocytes. Variants of this gene have been associated with multiple sclerosis, Crohn's disease, and chronic lymphocytic leukemia. Alternative splicing results in multiple variants. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (2) lacks multiple 3' exons, and has an alternate 3' sequence, as compared to variant 1. The encoded isoform 2 is much shorter and has a distinct C-terminus, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.