CPLX2 (NM_001008220) Human Untagged Clone

CAT#: SC301261

CPLX2 (untagged)-Human complexin 2 (CPLX2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CPLX2
• Synonyms: 921-L; CPX-2; CPX2; Hfb1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001008220, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACTTCGTCATGAAGCAGGCCCTTGGAGGGGCCACAAAGGACATGGGGAAGATGCTGGGGGGAGAGG
  AGGAGAAGGACCCCGACGCGCAGAAAAAGGAGGAGGAGCGGCAGGAGGCGCTGCGGCAGCAGGAGGAGGA
  GCGTAAGGCCAAGCACGCGCGCATGGAGGCGGAGCGGGAGAAGGTCCGGCAGCAGATCCGAGATAAGTAT
  GGGCTGAAGAAGAAGGAGGAGAAGGAAGCAGAGGAGAAAGCAGCCCTGGAGCAGCCCTGCGAGGGGAGCC
  TGACCCGGCCCAAGAAGGCCATCCCTGCGGGCTGCGGGGACGAGGAGGAGGAGGAAGAGGAGAGCATCCT
  GGACACGGTGCTCAAATACCTGCCCGGGCCGCTGCAGGACATGTTCAAGAAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001008220
• ORF Size: 405 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001008220.1, NP_001008221.1
• RefSeq Size: 4676
• RefSeq ORF: 405
• Locus ID: 10814
• Protein Families: Druggable Genome
• Gene Summary: Proteins encoded by the complexin/synaphin gene family are cytosolic proteins that function in synaptic vesicle exocytosis. These proteins bind syntaxin, part of the SNAP receptor. The protein product of this gene binds to the SNAP receptor complex and disrupts it, allowing transmitter release. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein.