IL4R (NM_001008699) Human Untagged Clone

CAT#: SC301344

IL4R (untagged)-Human interleukin 4 receptor (IL4R), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL4R
• Synonyms: CD124; IL4RA
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001008699 edited
  ATGGGGTGGCTTTGCTCTGGGCTCCTGTTCCCTGTGAGCTGCCTGGTCCTGCTGCAGGTG
  GCAAGCTCTGGGAACATGAAGGTCTTGCAGGAGCCCACCTGCGTCTCCGACTACATGAGC
  ATCTCTACTTGCGAGTGGAAGATGAATGGTCCCACCAATTGCAGCACCGAGCTCCGCCTG
  TTGTACCAGCTGGTTTTTCTGCTCTCCGAAGCCCACACGTGTATCCCTGAGAACAACGGA
  GGCGCGGGGTGCGTGTGCCACCTGCTCATGGATGACGTGGTCAGTGCGGATAACTATACA
  CTGGACCTGTGGGCTGGGCAGCAGCTGCTGTGGAAGGGCTCCTTCAAGCCCAGCGAGCAT
  GTGAAACCCAGGGCCCCAGGAAACCTGACAGTTCACACCAATGTCTCCGACACTCTGCTG
  CTGACCTGGAGCAACCCGTATCCCCCTGACAATTACCTGTATAATCATCTCACCTATGCA
  GTCAACATTTGGAGTGAAAACGACCCGGCAGATTTCAGAATCTATAACGTGACCTACCTA
  GAACCCTCCCTCCGCATCGCAGCCAGCACCCTGAAGTCTGGGATTTCCTACAGGGCACGG
  GTGAGGGCCTGGGCTCAGTGCTATAACACCACCTGGAGTGAGTGGAGCCCCAGCACCAAG
  TGGCACAACTCAAATATTTGCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001008699
• Insert Size: 700 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001008699.1, NP_001008699.1
• RefSeq Size: 1106 bp
• RefSeq ORF: 684 bp
• Locus ID: 3566
• Cytogenetics: 16p12.1
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway
• Gene Summary: 'This gene encodes the alpha chain of the interleukin-4 receptor, a type I transmembrane protein that can bind interleukin 4 and interleukin 13 to regulate IgE production. The encoded protein also can bind interleukin 4 to promote differentiation of Th2 cells. A soluble form of the encoded protein can be produced by proteolysis of the membrane-bound protein, and this soluble form can inhibit IL4-mediated cell proliferation and IL5 upregulation by T-cells. Allelic variations in this gene have been associated with atopy, a condition that can manifest itself as allergic rhinitis, sinusitus, asthma, or eczema. Polymorphisms in this gene are also associated with resistance to human immunodeficiency virus type-1 infection. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]'
  Transcript Variant: This variant (2) differs in the 3' UTR and coding region compared to variant 1. The resulting isoform (b) is shorter and has a distinct C-terminus compared to isoform a. Isoform b represents the soluble form of the receptor.