FOXP1 (NM_001012505) Human Untagged Clone
CAT#: SC301668
FOXP1 (untagged)-Human forkhead box P1 (FOXP1), transcript variant 2
"NM_001012505" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FOXP1 |
Synonyms | 12CC4; hFKH1B; HSPC215; MFH; QRF1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001012505, the custom clone sequence may differ by one or more nucleotides
ATGATGCAAGAATCTGGGACTGAGACAAAAAGTAACGGTTCAGCCATCCAGAATGGGTCG GGCGGCAGCAACCACTTACTAGAGTGCGGCGGTCTTCGGGAGGGGCGGTCCAACGGAGAG ACGCCGGCCGTGGACATCGGGGCAGCTGACCTCGCCCACGCCCAGCAGCAGCAGCAACAG TGGCATCTCATAAACCATCAGCCCTCTAGGAGTCCCAGCAGTTGGCTTAAGAGACTAATT TCAAGCCCTTGGGAGTTGGAAGTCCTGCAGGTCCCCTTGTGGGGAGCAGTTGCTGAGACG AAGATGAGTGGACCTGTGTGTCAGCCTAACCCTTCCCCATTTTGA |
Restriction Sites | Please inquire |
ACCN | NM_001012505 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001012505.1, NP_001012523.1 |
RefSeq Size | 937 bp |
RefSeq ORF | 345 bp |
Locus ID | 27086 |
Cytogenetics | 3p13 |
Protein Families | Transcription Factors |
Gene Summary | This gene belongs to subfamily P of the forkhead box (FOX) transcription factor family. Forkhead box transcription factors play important roles in the regulation of tissue- and cell type-specific gene transcription during both development and adulthood. Forkhead box P1 protein contains both DNA-binding- and protein-protein binding-domains. This gene may act as a tumor suppressor as it is lost in several tumor types and maps to a chromosomal region (3p14.1) reported to contain a tumor suppressor gene(s). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks multiple 3' exons but has an alternate exon in the 3' end, compared to variant 1. The encoded isoform b (previously called isoform 2) has a shorter and distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216342 | FOXP1 (Myc-DDK-tagged)-Human forkhead box P1 (FOXP1), transcript variant 2 |
USD 420.00 |
|
RG216342 | FOXP1 (GFP-tagged) - Human forkhead box P1 (FOXP1), transcript variant 2 |
USD 460.00 |
|
RC216342L3 | Lenti-ORF clone of FOXP1 (Myc-DDK-tagged)-Human forkhead box P1 (FOXP1), transcript variant 2 |
USD 620.00 |
|
RC216342L4 | Lenti-ORF clone of FOXP1 (mGFP-tagged)-Human forkhead box P1 (FOXP1), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review