Aurora C (AURKC) (NM_001015879) Human Untagged Clone
CAT#: SC302004
AURKC (untagged)-Human aurora kinase C (AURKC), transcript variant 2
"NM_001015879" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | AURKC |
Synonyms | AIE2; AIK3; ARK3; AurC; aurora-C; HEL-S-90; SPGF5; STK13 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001015879, the custom clone sequence may differ by one or more nucleotides
ATGGCTACAGCAAACCAAACAGCCCAGCAGCCCAGCAGCCCAGCCATGCGGCGCCTCACAGTCGATGACT TTGAAATCGGGCGTCCCCTGGGCAAGGGGAAATTTGGGAATGTGTACCTGGCTCGGCTCAAGGAAAGCCA TTTCATTGTGGCCCTGAAGGTTCTCTTCAAGTCGCAGATAGAGAAGGAAGGACTGGAGCACCAGCTGCGC CGGGAAATTGAGATCCAGGCTCATCTACAACACCCCAATATCCTGCGCCTGTATAACTATTTCCATGATG CACGCCGGGTGTACCTGATTCTGGAATATGCTCCAAGGGGTGAGCTCTACAAGGAGCTGCAGAAAAGCGA GAAATTAGATGAACAGCGCACAGCCACGATAATAGAGGAGTTGGCAGATGCCCTGACCTACTGCCATGAC AAGAAAGTGATTCACAGAGATATTAAGCCAGAGAACCTGCTGCTGGGGTTCAGGGGTGAGGTGAAGATTG CAGATTTTGGCTGGTCTGTGCACACCCCCTCCCTGAGGAGGAAGACAATGTGTGGGACACTGGACTACTT GCCGCCAGAAATGATTGAGGGGAGAACATATGATGAAAAGGTGGATTTGTGGTGCATTGGAGTGCTCTGC TATGAGCTGCTGGTGGGATATCCACCCTTTGAGAGCGCCTCCCACAGTGAGACTTACAGACGCATCCTCA AGGTAGATGTGAGGTTTCCACTATCAATGCCTCTGGGGGCCCGGGACTTGATTTCCAGGCTTCTCAGATA CCAGCCCTTGGAGAGACTGCCCCTGGCCCAGATCCTGAAGCACCCCTGGGTTCAGGCCCACTCCCGAAGG GTGCTGCCTCCCTGTGCTCAGATGGCTTCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001015879 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001015879.1, NP_001015879.1 |
RefSeq Size | 1120 bp |
RefSeq ORF | 873 bp |
Locus ID | 6795 |
Cytogenetics | 19q13.43 |
Protein Families | Druggable Genome, Protein Kinase |
Gene Summary | 'This gene encodes a member of the Aurora subfamily of serine/threonine protein kinases. The encoded protein is a chromosomal passenger protein that forms complexes with Aurora-B and inner centromere proteins and may play a role in organizing microtubules in relation to centrosome/spindle function during mitosis. This gene is overexpressed in several cancer cell lines, suggesting an involvement in oncogenic signal transduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (2), also known as Aurora C-SV, uses an alternate splice site at the 5' end of the first intron and an alternate upstream translation initiation site, compared to variant 1. The encoded protein (isoform 2) contains a shorter and distinct N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215418 | AURKC (Myc-DDK-tagged)-Human aurora kinase C (AURKC), transcript variant 2 |
USD 420.00 |
|
RG215418 | AURKC (GFP-tagged) - Human aurora kinase C (AURKC), transcript variant 2 |
USD 460.00 |
|
RC215418L3 | Lenti ORF clone of Human aurora kinase C (AURKC), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC215418L4 | Lenti ORF clone of Human aurora kinase C (AURKC), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review