PFKFB2 (NM_001018053) Human Untagged Clone

CAT#: SC302143

PFKFB2 (untagged)-Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 (PFKFB2), transcript variant 2


  "NM_001018053" in other vectors (6)

Reconstitution Protocol

USD 790.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PFKFB2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PFKFB2
Synonyms PFK-2/FBPase-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001018053, the custom clone sequence may differ by one or more nucleotides


ATGTCTGGGGCATCTTCCTCAGAACAGAACAACAACAGCTATGAAACCAAAACCCCAAATCTTCGAATGT
CAGAGAAGAAATGTTCATGGGCCTCCTACATGACCAACTCCCCGACTCTGATCGTTATGATTGGTTTGCC
AGCCCGGGGTAAAACCTACGTGTCCAAGAAACTAACACGCTACCTCAACTGGATTGGAGTCCCCACCAAA
GTGTTTAATCTTGGGGTGTATCGGCGTGAAGCAGTCAAGTCCTATAAGTCCTACGACTTCTTTCGGCATG
ACAATGAGGAGGCCATGAAGATCCGCAAACAGTGTGCTCTGGTGGCGCTGGAAGATGTTAAGGCGTATCT
CACTGAGGAGAATGGTCAGATTGCGGTGTTTGATGCCACCAATACAACCCGGGAGAGGAGGGACATGATT
TTGAACTTTGCTGAACAGAATTCCTTCAAGGTATTCTTTGTGGAATCCGTCTGTGATGATCCTGATGTCA
TTGCTGCCAATATTCTGGAGGTTAAGGTATCAAGCCCTGACTATCCTGAAAGGAACAGAGAGAACGTGAT
GGAGGACTTCCTGAAGAGAATTGAATGCTACAAAGTTACCTACCGACCTCTTGACCCAGACAACTATGAC
AAGGATCTTTCTTTCATCAAGGTGATAAACGTGGGCCAGCGATTTTTAGTCAACAGAGTCCAGGACTACA
TCCAGAGCAAGATAGTCTACTACCTCATGAATATCCACGTCCAGCCTCGCACCATTTACCTTTGCCGGCA
TGGAGAAAGCGAGTTCAATCTCTTGGGGAAGATTGGGGGTGACTCTGGCCTCTCGGTGCGGGGAAAGCAG
TTTGCCCAAGCTCTAAGGAAATTTCTGGAGGAACAGGAAATAACAGACCTCAAAGTGTGGACAAGCCAGT
TGAAGAGGACCATACAGACTGCTGAATCTCTCGGGGTGCCCTATGAGCAGTGGAAGATTCTGAATGAGAT
TGATGCTGGTGTGTGTGAAGAGATGACCTATGCAGAGATTGAGAAACGGTACCCAGAAGAGTTTGCACTT
CGAGATCAAGAGAAGTATCTGTATCGATATCCTGGTGGGGAGTCATACCAGGACCTGGTGCAGCGGCTGG
AGCCTGTCATCATGGAGCTGGAACGTCAGGGCAATGTCCTCGTCATCTCCCACCAGGCTGTCATGCGCTG
CCTCCTGGCCTACTTCTTGGATAAGGGCGCAGATGAGCTACCATACTTGAGATGCCCTCTCCATACCATC
TTCAAACTTACTCCTGTGGCCTATGGGTGCAAAGTGGAAACAATTAAACTTAACGTGGAGGCTGTGAACA
CGCACCGTGACAAGCCAACTGCAGCAGAGACCACACTGGCTGTGCGCAGACGCCCCTCCGCAGCGTCCCT
CATGTTGCCTTGCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001018053
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001018053.1, NP_001018063.1
RefSeq Size 3529 bp
RefSeq ORF 1416 bp
Locus ID 5208
Cytogenetics 1q32.1
Protein Families Druggable Genome
Protein Pathways Fructose and mannose metabolism
Gene Summary 'The protein encoded by this gene is involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate, and a fructose-2,6-biphosphatase activity that catalyzes the degradation of fructose-2,6-bisphosphate. This protein regulates fructose-2,6-bisphosphate levels in the heart, while a related enzyme encoded by a different gene regulates fructose-2,6-bisphosphate levels in the liver and muscle. This enzyme functions as a homodimer. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2) differs in the 3' UTR and coding region compared to variant 1. The resulting isoform (b) is shorter and has a distinct C-terminus compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.