HNMT (NM_001024075) Human Untagged Clone

CAT#: SC302229

HNMT (untagged)-Human histamine N-methyltransferase (HNMT), transcript variant 3


  "NM_001024075" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "HNMT"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HNMT
Synonyms HMT; HNMT-S1; HNMT-S2; MRT51
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001024075, the custom clone sequence may differ by one or more nucleotides
ATGGCATCTTCCATGAGGAGCTTGTTTTCTGACCACGGGAAATATGTTGAATCTTTCCGG
AGGTTTCTCAACCATTCCACGGAACACCAGTGCATGCAGGAATTCATGGACAAGAAGCTG
CCAGGCATAATAGGAAGGATTGGAGACACAAAATCAGAAATTAAGATTCTAAGCATAGGC
GGAGGTGCAGATTGTCTCATTCGGGGAAGCTCCAGGGTTCTCAAGCGGAATTCGTGTTTC
ATTTTGTGTAGCACCCGTCAGAAAGACAAGCCAGGCATGAGGATCCATGATGAGCGCTCT
TCTGAGTTGCCATTTGGAGCTGCCCGTTTAGAAAGCAAATCTGCATTTCCCTCATTCCTA
GTTTCCTTCATCCTCTTTTAA
Restriction Sites Please inquire     
ACCN NM_001024075
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001024075.1, NP_001019246.1
RefSeq Size 907 bp
RefSeq ORF 381 bp
Locus ID 3176
Cytogenetics 2q22.1
Protein Families Druggable Genome
Protein Pathways Histidine metabolism
Gene Summary 'In mammals, histamine is metabolized by two major pathways: N(tau)-methylation via histamine N-methyltransferase and oxidative deamination via diamine oxidase. This gene encodes the first enzyme which is found in the cytosol and uses S-adenosyl-L-methionine as the methyl donor. In the mammalian brain, the neurotransmitter activity of histamine is controlled by N(tau)-methylation as diamine oxidase is not found in the central nervous system. A common genetic polymorphism affects the activity levels of this gene product in red blood cells. Multiple alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (3), also called HNMT-S, includes an alternate exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.