BRMS1 (NM_001024957) Human Untagged Clone

CAT#: SC302327

BRMS1 (untagged)-Human breast cancer metastasis suppressor 1 (BRMS1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BRMS1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001024957, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCTGTCCAGCCTCCAAGCAAAGACACAGAAGAGATGGAAGCAGAGGGTGATTCTGCTGCTGAGATGA
  ATGGGGAGGAGGAAGAGAGTGAGGAGGAGCGGAGCGGCAGCCAGACAGAGTCAGAAGAGGAGAGCTCCGA
  GATGGATGATGAGGACTATGAGCGACGCCGCAGCGAGTGTGTCAGTGAGATGCTGGACCTAGAGAAGCAG
  TTCTCGGAGCTAAAGGAGAAGTTGTTCAGGGAACGACTGAGTCAGCTGCGGTTGCGGCTGGAGGAAGTGG
  GGGCTGAGAGAGCCCCTGAATACACGGAGCCCCTTGGGGGGCTGCAGCGGAGCCTCAAGATTCGCATTCA
  GGTGGCAGGGATCTACAAGGGCTTCTGTCTGGATGTGATCAGGAATAAGTACGAATGTGAGCTGCAGGGA
  GCCAAACAGCACCTGGAGAGTGAGAAGCTGCTGCTCTATGACACGCTGCAGGGGGAGCTGCAGGAGCGGA
  TCCAGAGGCTGGAGGAGGACCGCCAGAGCCTGGACCTCAGCTCTGAATGGTGGGATGACAAACTGCACGC
  CAGAGGCAGCTCCAGGTCTTGGGACTCCCTGCCGCCCAGCAAGAGGAAGAAGGCACCTCTGGTTTCTGGC
  CCATACATCGTGTACATGCTTCAAGAGATCGACATCCTGGAGGACTGGACAGCCATCAAAAAGGCTAGGG
  CAGCTGTGTCCCCTCAGAAGAGAAAATCGGATGACAGGCGGACCCACAGGCCCCTCAGGGTCTGCCCAGC
  CAGGCTCCTGTGGTGCTGCTGGGCCCTCCCACTCCATCTGGCACTGGCCTGGACTCCTCCTCTGCCCTCC
  TCGAGGCCTGCACAGCTGTGGCCGTGGAGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001024957
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001024957.1, NP_001020128.1
• RefSeq Size: 1360 bp
• RefSeq ORF: 873 bp
• Locus ID: 25855
• Cytogenetics: 11q13.2
• Protein Families: Druggable Genome
• Gene Summary: This gene reduces the metastatic potential, but not the tumorogenicity, of human breast cancer and melanoma cell lines. The protein encoded by this gene localizes primarily to the nucleus and is a component of the mSin3a family of histone deacetylase complexes (HDAC). The protein contains two coiled-coil motifs and several imperfect leucine zipper motifs. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) uses an alternate splice site in the 3' terminal exon which results in the use of a downstream stop codon, compared to variant 1. The encoded protein (isoform 2) has a longer and distinct C-terminus, compared to isoform 1.