CERKL (NM_001030313) Human Untagged Clone

CAT#: SC302513

CERKL (untagged)-Human ceramide kinase-like (CERKL), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CERKL
• Synonyms: RP26
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001030313, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCCTGGAGGAGGCGCAGGAACCGGGTGAGTGCCCTGGAGGGCGGCCGGGAGGAAGAGGCGCCCCCGG
  AGGCTGCCGCTGTGCCTCCGGCGCTGTTAACGTCCCCGCAGCAGACGGAGGCGGCGGCCGAGCGGATTCT
  GCTCCGGGGCATCTTCGAGATCGGGAGGGACAGTTGTGACGTGGTGCTGAGCGAGCGAGCACTGCGGTGG
  CGGCCCATTCAGCCCGAGCGCCCGGCGGGTGATTCTAAGTATGACTTGCTATGTAAAGAAGAATTTATTG
  AACTCAAAGACATATTCTCTGTGAAACTGAAACGGCGTTGTTCTGTTAAACAGCAGAGAAGTGGTACTTT
  ATTAGGTATCACACTCTTCATCTGCTTGAAAAAGGAACAAAATAAACTAAAGAATTCTACACTTGATCTT
  ATTAATTTAAGTGAAGACCACTGTGACATATGGTTTAGACAGTTCAAGAAAATATTGGCAGGCTTTCCAA
  ACAGACCGAAGTCATTAAAAATACTCCTTAACCCCCAAAGTCACAAAAAAGAAGCTACCCAGGTTTATTA
  TGAGAAGGTTGAACCTCTGTTGAAGCTTGCAGGAATAAAAACTGATGTAACAAGATCTACCAATGTATTG
  GCACATTCTCTTCATGGAGTTCCTCATGTGATAACTGCAACATTGCACATTATAATGGGGCATGTACAGC
  TGGTCGACGTCTGCACCTTCAGCACCGCTGGCAAGCTTCTTCGCTTTGGGTTCTCAGCCATGTTTGGCTT
  TGGTGGAAGAACTTTGGCTCTGGCAGAAAAATATCGATGGATGTCCCCTAACCAACGGAGAGATTTTGCT
  GTTGTTAAGGCACTGGCAAAACTTAAGGCAGAAGACTGTGAAATATCATTTTTACCATTTAACAGCTCTG
  ATGATGTGCAAGAAAGGAGGGCACAGGGATCTCCCAAATCTGACTGTAATGATCAATGGCAAATGATCCA
  GGGTCAGTTCTTGAATGTCAGCATTATGGCAATTCCTTGCCTGTGTTCAGTGGCACCTAGAGGCTTGGCA
  CCTAATACCAGATTAAATAATGGAAGTATGGCTCTTATAATTGCCCGAAACACTTCTCGGCCAGAATTTA
  TAAAACACCTGAAAAGATATGCCAGTGTAAAAAATCAGTTCAATTTTCCATTTGTTGAGACTTACACTGT
  TGAGGAAGTAAAAGTTCATCCAAGGAATAATACTGGTGGATATAATCCAGAGGAGGAGGAGGATGAAACT
  GCTTCAGAAAATTGTTTCCCTTGGAATGTAGATGGTGACTTAATGGAAGTTGCATCAGAGGTCCATATTA
  GATTGCATCCAAGACTTATCAGTCTTTATGGAGGAAGCATGGAAGAAATGATTCCAAAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001030313
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001030313.2, NP_001025484.1
• RefSeq Size: 3019 bp
• RefSeq ORF: 1392 bp
• Locus ID: 375298
• Cytogenetics: 2q31.3
• Protein Families: Druggable Genome
• Gene Summary: This gene was initially identified as a locus (RP26) associated with an autosomal recessive form of retinitis pigmentosa (arRP) disease. This gene encodes a protein with ceramide kinase-like domains, however, the protein does not phosphorylate ceramide and its target substrate is currently unknown. This protein may be a negative regulator of apoptosis in photoreceptor cells. Mutations in this gene cause a form of retinitis pigmentosa characterized by autosomal recessive cone and rod dystrophy (arCRD). Alternative splicing of this gene results in multiple transcript variants encoding different isoforms and non-coding transcripts. [provided by RefSeq, May 2010]
  Transcript Variant: This variant (4) lacks three alternate in-frame exons in the central coding region, compared to variant 2. The resulting isoform (4) lacks an internal segment, compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.