NABP1 (NM_001031716) Human Untagged Clone

CAT#: SC302561

NABP1 (untagged)-Human oligonucleotide/oligosaccharide-binding fold containing 2A (OBFC2A), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NABP1
• Synonyms: OBFC2A; SOSS-B2; SSB2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001031716 edited
  ATGAATAGGGTCAACGACCCACTTATTTTTATAAGAGATATTAAGCCCGGACTGAAAAAC
  TTAAATGTCGTCTTTATTGTCCTGGAGATAGGACGCGTGACCAAAACCAAAGACGGCCAT
  GAAGTGAGATCGTGCAAAGTAGCAGATAAAACGGGCAGCATCACTATTTCCGTGTGGGAT
  GAGATCGGAGGTCTTATACAGCCAGGGGATATTATTCGGTTGACCAGAGGGTATGCATCC
  ATGTGGAAAGGATGTCTGACACTTTATACTGGAAGGGGTGGTGAACTTCAAAAAATTGGG
  GAATTTTGTATGGTTTATTCAGAAGTGCCAAATTTCAGTGAACCCAACCCAGATTATCGA
  GGACAGCAGAACAAAGGGGCACAGAGTGAACAGAAGAATAATTCCATGAATAGTAATATG
  GGTACAGGTACATTTGGACCAGTGGGAAATGGTGTTCACACTGGCCCTGAATCAAGGGAA
  CACCAGTTTTCACATGCTGGCAGAAGCAATGGCCGGGGACTTATAAATCCACAACTACAA
  GGAACAGCTAGTAATCAAACAGTGATGACCACAATAAGTAATGGCAGGGACCCTCGGAGA
  GCCTTTAAAAGATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001031716
• Insert Size: 600 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001031716.1, NP_001026886.1
• RefSeq Size: 1879 bp
• RefSeq ORF: 615 bp
• Locus ID: 64859
• Cytogenetics: 2q32.3
• Gene Summary: Single-stranded DNA (ssDNA)-binding proteins, such as OBFC2A, are ubiquitous and essential for a variety of DNA metabolic processes, including replication, recombination, and detection and repair of damage (Richard et al., 2008 [PubMed 18449195]). [supplied by OMIM, Jun 2008]
  Transcript Variant: This variant (1) encodes the longer isoform (1).