c Maf (MAF) (NM_001031804) Human Untagged Clone

CAT#: SC302598

MAF (untagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) (MAF), transcript variant 2


  "NM_001031804" in other vectors (6)

Reconstitution Protocol

USD 760.00

5 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAF
Synonyms AYGRP; c-MAF; CCA4; CTRCT21
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001031804, the custom clone sequence may differ by one or more nucleotides
ATGGCATCAGAACTGGCAATGAGCAACTCCGACCTGCCCACCAGTCCCCTGGCCATGGAA
TATGTTAATGACTTCGATCTGATGAAGTTTGAAGTGAAAAAGGAACCGGTGGAGACCGAC
CGCATCATCAGCCAGTGCGGCCGTCTCATCGCCGGGGGCTCGCTGTCCTCCACCCCCATG
AGCACGCCGTGCAGCTCGGTGCCCCCTTCCCCCAGCTTCTCGGCGCCCAGCCCGGGCTCG
GGCAGCGAGCAGAAGGCGCACCTGGAAGACTACTACTGGATGACCGGCTACCCGCAGCAG
CTGAACCCCGAGGCGCTGGGCTTCAGCCCCGAGGACGCGGTCGAGGCGCTCATCAGCAAC
AGCCACCAGCTCCAGGGCGGCTTCGATGGCTACGCGCGCGGGGCGCAGCAGCTGGCCGCG
GCGGCCGGGGCCGGTGCCGGCGCCTCCTTGGGCGGCAGCGGCGAGGAGATGGGCCCCGCC
GCCGCCGTGGTGTCCGCCGTGATCGCCGCGGCCGCCGCGCAGAGCGGCGCGGGCCCGCAC
TACCACCACCACCACCACCACGCCGCCGGCCACCACCACCACCCGACGGCCGGCGCGCCC
GGCGCCGCGGGCAGCGCGGCCGCCTCGGCCGGTGGCGCTGGGGGCGCGGGCGGCGGTGGC
CCGGCCAGCGCTGGGGGCGGCGGCGGCGGCGGCGGCGGCGGAGGCGGCGGGGGCGCGGCG
GGGGCGGGGGGCGCCCTGCACCCGCACCACGCCGCCGGCGGCCTGCACTTCGACGACCGC
TTCTCCGACGAGCAGCTGGTGACCATGTCTGTGCGCGAGCTGAACCGGCAGCTGCGCGGG
GTCAGCAAGGAGGAGGTGATCCGGCTGAAGCAGAAGAGGCGGACCCTGAAAAACCGCGGC
TATGCCCAGTCCTGCCGCTTCAAGAGGGTGCAGCAGAGACACGTCCTGGAGTCGGAGAAG
AACCAGCTGCTGCAGCAAGTCGACCACCTCAAGCAGGAGATCTCCAGGCTGGTGCGCGAG
AGGGACGCGTACAAGGAGAAATACGAGAAGTTGGTGAGCAGCGGCTTCCGAGAAAACGGC
TCGAGCAGCGACAACCCGTCCTCTCCCGAGTTTTTCATGTGA
Restriction Sites Please inquire     
ACCN NM_001031804
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001031804.1, NP_001026974.1
RefSeq Size 6392 bp
RefSeq ORF 1122 bp
Locus ID 4094
Cytogenetics 16q23.2
Protein Families Druggable Genome, Transcription Factors
Gene Summary 'The protein encoded by this gene is a DNA-binding, leucine zipper-containing transcription factor that acts as a homodimer or as a heterodimer. Depending on the binding site and binding partner, the encoded protein can be a transcriptional activator or repressor. This protein plays a role in the regulation of several cellular processes, including embryonic lens fiber cell development, increased T-cell susceptibility to apoptosis, and chondrocyte terminal differentiation. Defects in this gene are a cause of juvenile-onset pulverulent cataract as well as congenital cerulean cataract 4 (CCA4). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]'
Transcript Variant: This variant (2) represents an unspliced transcript compared to variant 1, which results in a frame-shift and a shorter isoform (b) with a distinct C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no quality transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.