FAIM1 (FAIM) (NM_001033031) Human Untagged Clone

CAT#: SC302679

FAIM (untagged)-Human Fas apoptotic inhibitory molecule (FAIM), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FAIM
• Synonyms: FAIM1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001033031, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCATCTGGAGATGACAGTCCTATCTTTGAAGATGATGAAAGCCCTCCTTACAGCCTAGAAAAAATGA
  CAGATCTCGTAGCTGTTTGGGATGTTGCTTTAAGTGACGGAGTCCACAAGATCGAATTTGAACATGGGAC
  TACATCAGGCAAACGAGTAGTATATGTAGATGGAAAGGAAGAGATAAGAAAAGAGTGGATGTTCAAATTA
  GTGGGCAAAGAAACATTCTATGTTGGAGCTGCAAAGACAAAAGCGACCATAAATATAGACGCTATCAGTG
  GTTTTGCTTATGAATATACTCTGGAAATTAATGGGAAAAGTCTCAAGAAGTATATGGAGGACAGATCAAA
  AACCACCAATACTTGGGTATTACACATGGATGGTGAGAACTTTAGAATTGTTTTGGAAAAAGATGCTATG
  GACGTATGGTGCAATGGTAAAAAATTGGAGACAGCGGGTGAGTTTGTAGATGATGGGACTGAAACTCACT
  TCAGTATCGGGAACCATGACTGTTACATAAAGGCTGTCAGTAGTGGGAAGCGGAAAGAAGGGATTATTCA
  TACTCTCATTGTGGATAATAGAGAAATCCCAGAGATTGCAAGTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001033031
• ORF Size: 606 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001033031.1, NP_001028203.1
• RefSeq Size: 1164
• RefSeq ORF: 606
• Locus ID: 55179
• Gene Summary: The protein encoded by this gene protects against death receptor-triggered apoptosis and regulates B-cell signaling and differentiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
  Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) has a shorter and distinct N-terminus compared to isoform a.