SAR1B (NM_001033503) Human Untagged Clone

CAT#: SC302705

SAR1B (untagged)-Human SAR1 homolog B (S. cerevisiae) (SAR1B), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SAR1B
• Synonyms: ANDD; CMRD; GTBPB; SARA2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001033503, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCTTCATATTTGATTGGATTTACAGTGGTTTCAGCAGTGTGCTACAGTTTTTAGGATTATATAAGA
  AAACTGGTAAACTGGTATTTCTTGGATTGGATAATGCAGGAAAAACAACATTGCTACACATGCTAAAAGA
  TGACAGACTTGGACAACATGTCCCAACATTACATCCCACTTCCGAAGAACTGACCATTGCTGGCATGACG
  TTTACAACTTTTGATCTGGGTGGACATGTTCAAGCTCGAAGAGTGTGGAAAAACTACCTTCCTGCTATCA
  ATGGCATTGTATTTCTGGTGGATTGTGCAGACCACGAAAGGCTGTTAGAGTCAAAAGAAGAACTTGATTC
  ACTAATGACAGATGAAACCATTGCTAATGTGCCTATACTGATTCTTGGGAATAAGATCGACAGACCTGAA
  GCCATCAGTGAAGAGAGGTTGCGAGAGATGTTTGGTTTATATGGTCAGACAACAGGAAAGGGGAGTATAT
  CTCTGAAAGAACTGAATGCCCGACCCTTAGAAGTTTTCATGTGTAGTGTGCTCAAAAGACAAGGTTACGG
  AGAAGGCTTCCGCTGGATGGCACAGTACATTGATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001033503
• ORF Size: 597 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001033503.2, NP_001028675.1
• RefSeq Size: 6651
• RefSeq ORF: 597
• Locus ID: 51128
• Gene Summary: The protein encoded by this gene is a small GTPase that acts as a homodimer. The encoded protein is activated by the guanine nucleotide exchange factor PREB and is involved in protein transport from the endoplasmic reticulum to the Golgi. This protein is part of the COPII coat complex. Defects in this gene are a cause of chylomicron retention disease (CMRD), also known as Anderson disease (ANDD). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Mar 2010]
  Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.