SSX4 (SSX4B) (NM_001034832) Human Untagged Clone

CAT#: SC302796

SSX4B (untagged)-Human synovial sarcoma, X breakpoint 4B (SSX4B), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SSX4B
• Synonyms: CT5.4
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001034832, the custom clone sequence may differ by one or more nucleotides
  ATGAACGGAGACGACGCCTTTGCAAGGAGACCCAGGGATGATGCTCAAATATCAGAGAAG
  TTACGAAAGGCCTTCGATGATATTGCCAAATACTTCTCTAAGAAAGAGTGGGAAAAGATG
  AAATCCTCGGAGAAAATCGTCTATGTGTATATGAAGCTAAACTATGAGGTCATGACTAAA
  CTAGGTTTCAAGGTCACCCTCCCACCTTTCATGCGTAGTAAACGGGCTGCAGACTTCCAC
  GGGAATGATTTTGGTAACGATCGAAACCACAGGAATCAGGTTGAACGTCCTCAGATGACT
  TTCGGCAGCCTCCAGAGAATCTTCCCGAAGATCATGCCCAAGAAGCCAGCAGAGGAAGAA
  AATGGTTTGAAGGAAGTGCCAGAGGCATCTGGCCCACAAAATGATGGGAAACAGCTGTGC
  CCCCCGGGAAATCCAAGTACCTTGGAGAAGATTAACAAGACATCTGGACCCAAAAGGGGG
  AAACATGCCTGGACCCACAGACTGCGTGAGAGAAAGCAGCTGGTGGTTTATGAAGAGATC
  AGCGACCCTGAGGAAGATGACGAGTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001034832
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001034832.1, NP_001030004.1
• RefSeq Size: 1322 bp
• RefSeq ORF: 567 bp
• Locus ID: 548313
• Cytogenetics: Xp11.23
• Gene Summary: The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneously humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. SSX1, SSX2 and SSX4 genes have been involved in the t(X;18) translocation characteristically found in all synovial sarcomas. This translocation results in the fusion of the synovial sarcoma translocation gene on chromosome 18 to one of the SSX genes on chromosome X. Chromosome Xp11 contains a segmental duplication resulting in two identical copies of synovial sarcoma, X breakpoint 4, SSX4 and SSX4B, in tail-to-tail orientation. This gene, SSX4B, represents the more centromeric copy. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). ##RefSeq-Attributes-START## RefSeq Select criteria :: based on expression, longest protein ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.