DYNLL1 (NM_001037494) Human Untagged Clone

CAT#: SC302899

DYNLL1 (untagged)-Human dynein, light chain, LC8-type 1 (DYNLL1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DYNLL1
• Synonyms: DLC1; DLC8; DNCL1; DNCLC1; hdlc1; LC8; LC8a; PIN
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001037494, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTGCGACCGAAAGGCCGTGATCAAAAATGCGGACATGTCGGAAGAGATGCAACAGGACTCGGTGGAGT
  GCGCTACTCAGGCGCTGGAGAAATACAACATAGAGAAGGACATTGCGGCTCATATCAAGAAGGAATTTGA
  CAAGAAGTACAATCCCACCTGGCATTGCATCGTGGGGAGGAACTTCGGTAGTTATGTGACACATGAAACC
  AAACACTTCATCTACTTCTACCTGGGCCAAGTGGCCATTCTTCTGTTCAAATCTGGTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001037494
• ORF Size: 270 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001037494.1, NP_001032583.1
• RefSeq Size: 820
• RefSeq ORF: 270
• Locus ID: 8655
• Gene Summary: Cytoplasmic dyneins are large enzyme complexes with a molecular mass of about 1,200 kD. They contain two force-producing heads formed primarily from dynein heavy chains, and stalks linking the heads to a basal domain, which contains a varying number of accessory intermediate chains. The complex is involved in intracellular transport and motility. The protein described in this record is a light chain and exists as part of this complex but also physically interacts with and inhibits the activity of neuronal nitric oxide synthase. Binding of this protein destabilizes the neuronal nitric oxide synthase dimer, a conformation necessary for activity, and it may regulate numerous biologic processes through its effects on nitric oxide synthase activity. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) represents the longest transcript. . Variants 1, 2 and 3 encode the same protein.