Orexin (HCRT) (NM_001524) Human Untagged Clone
CAT#: SC303041
HCRT (untagged)-Human hypocretin (orexin) neuropeptide precursor (HCRT)
"NM_001524" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HCRT |
Synonyms | NRCLP1; OX; PPOX |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001524 edited
GGTACCAGACACCATGAACCTTCCTTCCACAAAGGTCTCCTGGGCCGCCGTGACGCTACT GCTGCTGCTGCTGCTGCTGCCGCCCGCGCTGTTGTCGTCCGGGGCGGCTGCACAGCCCCT GCCCGACTGCTGTCGTCAAAAGACTTGCTCTTGCCGCCTCTACGAGCTGCTGCACGGCGC GGGCAATCACGCGGCCGGCATCCTCACGCTGGGCAAGCGGAGGTCCGGGCCCCCGGGCCT CCAGGGTCGGCTGCAGCGCCTCCTGCAGGCCAGCGGCAACCACGCCGCGGGCATCCTGAC CATGGGCCGCCGCGCAGGCGCAGAGCCAGCGCCGCGCCCCTGCCTCGGGCGCCGCTGTTC CGCCCCGGCCGCCGCCTCCGTCGCGCCCGGAGGACAGTCCGGGATCTGAGTCGTTCTTCG GGCCCTGTCCTGGCCCAGGCCTCTGCCCTCTGCCCACCCAGCGTCAGCCCCCAGAAAAAA GGCAATAAAGACGAGTCTCCATCTAGA |
Restriction Sites | Please inquire |
ACCN | NM_001524 |
Insert Size | 500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_001524.1. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001524.1, NP_001515.1 |
RefSeq Size | 577 bp |
RefSeq ORF | 396 bp |
Locus ID | 3060 |
Cytogenetics | 17q21.2 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | 'This gene encodes a hypothalamic neuropeptide precursor protein that gives rise to two mature neuropeptides, orexin A and orexin B, by proteolytic processing. Orexin A and orexin B, which bind to orphan G-protein coupled receptors HCRTR1 and HCRTR2, function in the regulation of sleep and arousal. This neuropeptide arrangement may also play a role in feeding behavior, metabolism, and homeostasis. [provided by RefSeq, Jan 2010]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217956 | HCRT (Myc-DDK-tagged)-Human hypocretin (orexin) neuropeptide precursor (HCRT) |
USD 420.00 |
|
RG217956 | HCRT (GFP-tagged) - Human hypocretin (orexin) neuropeptide precursor (HCRT) |
USD 460.00 |
|
RC217956L1 | Lenti ORF clone of Human hypocretin (orexin) neuropeptide precursor (HCRT), Myc-DDK-tagged |
USD 768.00 |
|
RC217956L2 | Lenti ORF clone of Human hypocretin (orexin) neuropeptide precursor (HCRT), mGFP tagged |
USD 620.00 |
|
RC217956L3 | Lenti ORF clone of Human hypocretin (orexin) neuropeptide precursor (HCRT), Myc-DDK-tagged |
USD 620.00 |
|
RC217956L4 | Lenti ORF clone of Human hypocretin (orexin) neuropeptide precursor (HCRT), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review