FGF9 (NM_002010) Human Untagged Clone

CAT#: SC303107

FGF9 (untagged)-Human fibroblast growth factor 9 (glia-activating factor) (FGF9)


  "NM_002010" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "FGF9"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FGF9
Synonyms FGF-9; GAF; HBFG-9; HBGF-9; SYNS3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_002010, the custom clone sequence may differ by one or more nucleotides


ATGGCTCCCTTAGGTGAAGTTGGGAACTATTTCGGTGTGCAGGATGCGGTACCGTTTGGGAATGTGCCCG
TGTTGCCGGTGGACAGCCCGGTTTTGTTAAGTGACCACCTGGGTCAGTCCGAAGCAGGGGGGCTCCCCAG
GGGACCCGCAGTCACGGACTTGGATCATTTAAAGGGGATTCTCAGGCGGAGGCAGCTATACTGCAGGACT
GGATTTCACTTAGAAATCTTCCCCAATGGTACTATCCAGGGAACCAGGAAAGACCACAGCCGATTTGGCA
TTCTGGAATTTATCAGTATAGCAGTGGGCCTGGTCAGCATTCGAGGCGTGGACAGTGGACTCTACCTCGG
GATGAATGAGAAGGGGGAGCTGTATGGATCAGAAAAACTAACCCAAGAGTGTGTATTCAGAGAACAGTTC
GAAGAAAACTGGTATAATACGTACTCATCAAACCTATATAAGCACGTGGACACTGGAAGGCGATACTATG
TTGCATTAAATAAAGATGGGACCCCGAGAGAAGGGACTAGGACTAAACGGCACCAGAAATTCACACATTT
TTTACCTAGACCAGTGGACCCCGACAAAGTACCTGAACTGTATAAGGATATTCTAAGCCAAAGTTGA


Restriction Sites Please inquire     
ACCN NM_002010
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002010.1, NP_002001.1
RefSeq Size 1420 bp
RefSeq ORF 627 bp
Locus ID 2254
Cytogenetics 13q12.11
Protein Families Druggable Genome, Secreted Protein
Protein Pathways MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton
Gene Summary 'The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein was isolated as a secreted factor that exhibits a growth-stimulating effect on cultured glial cells. In nervous system, this protein is produced mainly by neurons and may be important for glial cell development. Expression of the mouse homolog of this gene was found to be dependent on Sonic hedgehog (Shh) signaling. Mice lacking the homolog gene displayed a male-to-female sex reversal phenotype, which suggested a role in testicular embryogenesis. [provided by RefSeq, Jul 2008]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.