GNAL (NM_002071) Human Untagged Clone

CAT#: SC303116

GNAL (untagged)-Human guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type (GNAL), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GNAL
• Synonyms: guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type; guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide, olfactory type
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_002071 edited
  ATGGGGTGTTTGGGCGGCAACAGCAAGACGACGGAAGACCAGGGCGTCGATGAAAAAGAA
  CGACGCGAGGCCAACAAAAAGATCGAGAAGCAGTTGCAGAAAGAGCGCCTGGCTTACAAG
  GCTACCCACCGCCTGCTGCTCCTGGGGGCTGGTGAGTCTGGGAAAAGCACTATCGTCAAA
  CAGATGAGGATCCTGCACGTCAATGGGTTTAATCCCGAGGAAAAGAAACAGAAAATTCTG
  GACATCCGGAAAAATGTTAAAGATGCTATCGTGACAATTGTTTCAGCAATGAGTACTATA
  ATACCTCCAGTTCCGCTGGCCAACCCTGAAAACCAATTTCGATCAGACTACATCAAGAGC
  ATAGCCCCTATCACTGACTTTGAATATTCCCAGGAATTCTTTGACCATGTGAAAAAACTT
  TGGGACGATGAAGGCGTGAAGGCATGCTTTGAGAGATCCAACGAATACCAGCTGATTGAC
  TGTGCACAATACTTCCTGGAAAGAATCGACAGCGTCAGCTTGGTTGACTACACACCCACA
  GACCAGGACCTCCTCAGATGCAGAGTTCTGACATCTGGGATTTTTGAGACACGATTCCAA
  GTGGACAAAGTAAACTTCCACATGTTTGATGTTGGTGGCCAGAGGGATGAGAGGAGAAAA
  TGGATCCAGTGCTTTAACGATGTCACAGCTATCATTTACGTCGCAGCCTGCAGTAGCTAC
  AACATGGTGATTCGAGAAGATAACAACACCAACAGGCTGAGAGAGTCCCTGGATCTTTTT
  GAAAGCATCTGGAACAACAGGTGGTTACGGACCATTTCTATCATCTTGTTCTTGAACAAA
  CAAGATATGCTGGCAGAAAAAGTCTTGGCAGGGAAATCAAAAATTGAAGACTATTTCCCA
  GAATATGCAAATTATACTGTTCCTGAAGACGCAACACCAGATGCAGGAGAAGATCCCAAA
  GTTACAAGAGCCAAGTTCTTTATCCGGGACCTGTTTTTGAGGATCAGCACGGCCACCGGT
  GACGGCAAACATTACTGCTACCCGCACTTCACCTGCGCCGTGGACACAGAGAACATCCGC
  AGGGTGTTCAACGACTGCCGCGACATCATCCAGCGGATGCACCTCAAGCAGTATGAGCTC
  TTGTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_002071
• Insert Size: 1100 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002071.1, NP_002062.1
• RefSeq Size: 2092 bp
• RefSeq ORF: 1146 bp
• Locus ID: 2774
• Cytogenetics: 18p11.21
• Protein Families: Druggable Genome
• Protein Pathways: Calcium signaling pathway, Olfactory transduction
• Gene Summary: 'This gene encodes a stimulatory G protein alpha subunit which mediates odorant signaling in the olfactory epithelium. This protein couples dopamine type 1 receptors and adenosine A2A receptors and is widely expressed in the central nervous system. Mutations in this gene have been associated with dystonia 25 and this gene is located in a susceptibility region for bipolar disorder and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]'