LMO1 (NM_002315) Human Untagged Clone

CAT#: SC303178

LMO1 (untagged)-Human LIM domain only 1 (rhombotin 1) (LMO1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LMO1
• Synonyms: RBTN1; RHOM1; TTG1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_002315, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATGGTGCTGGACAAGGAGGACGGCGTGCCGATGCTCTCCGTCCAGCCCAAAGGGAAGCAGAAGGGCT
  GTGCGGGCTGTAACCGCAAGATCAAGGACCGCTATCTGCTGAAGGCATTGGACAAGTACTGGCACGAAGA
  CTGCCTCAAGTGTGCCTGCTGTGACTGCCGCCTGGGCGAGGTGGGCTCCACCCTCTACACCAAGGCCAAC
  CTCATCCTGTGCCGACGCGACTACCTGAGGCTCTTTGGCACCACAGGGAACTGTGCTGCTTGCAGCAAGC
  TGATCCCAGCCTTCGAGATGGTGATGCGGGCCCGGGACAACGTGTATCACCTCGACTGCTTCGCCTGCCA
  GCTCTGCAACCAGAGATTTTGTGTGGGAGACAAATTCTTCCTGAAGAACAACATGATCTTGTGTCAGATG
  GACTATGAGGAAGGGCAGCTCAATGGCACCTTTGAATCCCAAGTTCAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_002315
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002315.2, NP_002306.1
• RefSeq Size: 1315 bp
• RefSeq ORF: 471 bp
• Locus ID: 4004
• Cytogenetics: 11p15.4
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: 'This locus encodes a transcriptional regulator that contains two cysteine-rich LIM domains but lacks a DNA-binding domain. LIM domains may play a role in protein interactions; thus the encoded protein may regulate transcription by competitively binding to specific DNA-binding transcription factors. Alterations at this locus have been associated with acute lymphoblastic T-cell leukemia. Chromosomal rearrangements have been observed between this locus and at least two loci, the delta subunit of the T-cell antigen receptor gene and the LIM domain binding 1 gene. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2012]'
  Transcript Variant: This variant (1) encodes the longer isoform (a).