Nkx2.2 (NKX2-2) (NM_002509) Human Untagged Clone

CAT#: SC303209

NKX2 (untagged)-Human NK2 homeobox 2 (NKX2-2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NKX2-2
• Synonyms: NKX2.2; NKX2B
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_002509 edited
  TGCGACATAAATTTTGGGGTCTCGAACCATGTCGCTGACCAACACAAAGACGGGGTTTTC
  GGTCAAGGACATCTTAGACCTGCCGGACACCAACGATGAGGAGGGCTCTGTGGCCGAAGG
  TCCGGAGGAAGAGAACGAGGGGCCCGAGCCAGCCAAGAGGGCCGGGCCGCTGGGGCAGGG
  CGCCCTGGACGCGGTGCAGAGCCTGCCCCTGAAGAACCCCTTCTACGACAGCAGCGACAA
  CCCGTACACGCGCTGGCTGGCCAGCACCGAGGGCCTTCAGTACTCCCTGCACGGTCTGGC
  TGCCGGGGCGCCCCCTCAGGACTCAAGCTCCAAGTCCCCGGAGCCCTCGGCCGACGAGTC
  ACCGGACAATGACAAGGAGACCCCGGGCGGCGGGGGGGACGCCGGCAAGAAGCGAAAGCG
  GCGAGTGCTTTTCTCCAAGGCGCAGACCTACGAGCTGGAGCGGCGCTTTCGGCAGCAGCG
  GTACCTGTCGGCGCCCGAGCGCGAACACCTGGCCAGCCTCATCCGCCTCACGCCCACGCA
  GGTCAAGATCTGGTTCCAGAACCACCGCTACAAGATGAAGCGCGCCCGGGCCGAGAAAGG
  TATGGAGGTGACGCCCCTGCCCTCGCCGCGCCGGGTGGCCGTGCCCGTCTTGGTCAGGGA
  CGGCAAACCATGTCACGCGCTCAAAGCCCAGGACCTGGCAGCCGCCACCTTCCAGGCGGG
  CATTCCCTTTTCTGCCTACAGCGCGCAGTCGCTGCAGCACATGCAGTACAACGCCCAGTA
  CAGCTCGGCCAGCACCCCCCAGTACCCGACAGCACACCCCCTGGTCCAGGCCCAGCAGTG
  GACTTGGTGAGCGCCGCCCCAACGAGACTC
  
• Restriction Sites: Please inquire
• ACCN: NM_002509
• Insert Size: 900 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002509.2.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002509.2, NP_002500.1
• RefSeq Size: 2092 bp
• RefSeq ORF: 822 bp
• Locus ID: 4821
• Cytogenetics: 20p11.22
• Protein Families: Transcription Factors
• Protein Pathways: Maturity onset diabetes of the young
• Gene Summary: 'The protein encoded by this gene contains a homeobox domain and may be involved in the morphogenesis of the central nervous system. This gene is found on chromosome 20 near NKX2-4, and these two genes appear to be duplicated on chromosome 14 in the form of TITF1 and NKX2-8. The encoded protein is likely to be a nuclear transcription factor. [provided by RefSeq, Jul 2008]'