SERPINB4 (NM_002974) Human Untagged Clone
CAT#: SC303256
SERPINB4 (untagged)-Human serpin peptidase inhibitor, clade B (ovalbumin), member 4 (SERPINB4)
"NM_002974" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SERPINB4 |
Synonyms | LEUPIN; PI11; SCCA-2; SCCA1; SCCA2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_002974, the custom clone sequence may differ by one or more nucleotides
ATGAATTCACTCAGTGAAGCCAACACCAAGTTCATGTTCGATCTGTTCCAACAGTTCAGAAAATCAAAAG AGAACAACATCTTCTATTCCCCTATCAGCATCACATCAGCATTAGGGATGGTCCTCTTAGGAGCCAAAGA CAACACTGCACAACAAATTAGCAAGGTTCTTCACTTTGATCAAGTCACAGAGAACACCACAGAAAAAGCT GCAACATATCATGTTGATAGGTCAGGAAATGTTCATCACCAGTTTCAAAAGCTTCTGACTGAATTCAACA AATCCACTGATGCATATGAGCTGAAGATCGCCAACAAGCTCTTCGGAGAAAAGACGTATCAATTTTTACA GGAATATTTAGATGCCATCAAGAAATTTTACCAGACCAGTGTGGAATCTACTGATTTTGCAAATGCTCCA GAAGAAAGTCGAAAGAAGATTAACTCCTGGGTGGAAAGTCAAACGAATGAAAAAATTAAAAACCTATTTC CTGATGGGACTATTGGCAATGATACGACACTGGTTCTTGTGAACGCAATCTATTTCAAAGGGCAGTGGGA GAATAAATTTAAAAAAGAAAACACTAAAGAGGAAAAATTTTGGCCAAACAAGAATACATACAAATCTGTA CAGATGATGAGGCAATACAATTCCTTTAATTTTGCCTTGCTGGAGGATGTACAGGCCAAGGTCCTGGAAA TACCATACAAAGGCAAAGATCTAAGCATGATTGTGCTGCTGCCAAATGAAATCGATGGTCTGCAGAAGCT TGAAGAGAAACTCACTGCTGAGAAATTGATGGAATGGACAAGTTTGCAGAATATGAGAGAGACATGTGTC GATTTACACTTACCTCGGTTCAAAATGGAAGAGAGCTATGACCTCAAGGACACGTTGAGAACCATGGGAA TGGTGAATATCTTCAATGGGGATGCAGACCTCTCAGGCATGACCTGGAGCCACGGTCTCTCAGTATCTAA AGTCCTACACAAGGCCTTTGTGGAGGTCACTGAGGAGGGAGTGGAAGCTGCAGCTGCCACCGCTGTAGTA GTAGTCGAATTATCATCTCCTTCAACTAATGAAGAGTTCTGTTGTAATCACCCTTTCCTATTCTTCATAA GGCAAAATAAGACCAACAGCATCCTCTTCTATGGCAGATTCTCATCCCCATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_002974 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002974.3, NP_002965.1 |
RefSeq Size | 1787 bp |
RefSeq ORF | 1173 bp |
Locus ID | 6318 |
Cytogenetics | 18q21.33 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | 'The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein is highly expressed in many tumor cells and can inactivate granzyme M, an enzyme that kills tumor cells. This protein, along with serpin B3, can be processed into smaller fragments that aggregate to form an autoantigen in psoriasis, probably by causing chronic inflammation. [provided by RefSeq, Jan 2017]' Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC321095 | SERPINB4 (untagged)-Human serpin peptidase inhibitor, clade B (ovalbumin), member 4 (SERPINB4) |
USD 760.00 |
|
RC205612 | SERPINB4 (Myc-DDK-tagged)-Human serpin peptidase inhibitor, clade B (ovalbumin), member 4 (SERPINB4) |
USD 420.00 |
|
RG205612 | SERPINB4 (GFP-tagged) - Human serpin peptidase inhibitor, clade B (ovalbumin), member 4 (SERPINB4) |
USD 460.00 |
|
RC205612L1 | Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 4 (SERPINB4), Myc-DDK-tagged |
USD 768.00 |
|
RC205612L2 | Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 4 (SERPINB4), mGFP tagged |
USD 620.00 |
|
RC205612L3 | Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 4 (SERPINB4), Myc-DDK-tagged |
USD 620.00 |
|
RC205612L4 | Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 4 (SERPINB4), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review