beta Crystallin A3 (CRYBA1) (NM_005208) Human Untagged Clone

CAT#: SC303602

CRYBA1 (untagged)-Human crystallin, beta A1 (CRYBA1)


  "NM_005208" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CRYBA1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CRYBA1
Synonyms CRYB1; CTRCT10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_005208, the custom clone sequence may differ by one or more nucleotides


ATGGAGACCCAGGCTGAGCAGCAGGAGCTGGAAACCCTTCCAACCACCAAGATGGCTCAGACCAACCCTA
CGCCGGGGTCCCTGGGGCCATGGAAGATAACCATCTATGATCAGGAGAACTTTCAGGGCAAGAGGATGGA
GTTCACCAGCTCCTGTCCAAATGTCTCTGAGCGCAGTTTTGATAATGTCCGGTCCCTGAAGGTGGAAAGT
GGCGCCTGGATTGGTTATGAGCATACCAGCTTCTGTGGGCAACAGTTTATCCTGGAGAGAGGAGAATACC
CTCGCTGGGATGCCTGGAGTGGGAGTAATGCCTACCACATTGAGCGTCTCATGTCCTTCCGCCCCATCTG
TTCAGCTAATCATAAGGAGTCTAAGATGACCATCTTTGAGAAGGAAAACTTTATTGGACGCCAGTGGGAG
ATCTCTGACGACTACCCCTCCTTGCAAGCCATGGGCTGGTTCAACAACGAAGTCGGCTCCATGAAGATAC
AAAGTGGGGCCTGGGTTTGCTACCAATATCCTGGATATCGTGGGTATCAGTATATCTTGGAATGTGACCA
TCATGGAGGAGACTATAAACATTGGAGAGAGTGGGGCTCTCATGCCCAGACTTCGCAGATCCAATCGATT
CGCCGAATCCAACAGTAG


Restriction Sites SgfI-MluI     
ACCN NM_005208
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005208.4, NP_005199.2
RefSeq Size 806 bp
RefSeq ORF 648 bp
Locus ID 1411
Cytogenetics 17q11.2
Gene Summary 'Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group, none in the acidic group). Beta-crystallins form aggregates of different sizes and are able to self-associate to form dimers or to form heterodimers with other beta-crystallins. This gene, a beta acidic group member, encodes two proteins (crystallin, beta A3 and crystallin, beta A1) from a single mRNA, the latter protein is 17 aa shorter than crystallin, beta A3 and is generated by use of an alternate translation initiation site. Deletion of exons 3 and 4 causes the autosomal dominant disease 'zonular cataract with sutural opacities'. [provided by RefSeq, Jul 2008]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.