beta Crystallin A3 (CRYBA1) (NM_005208) Human Untagged Clone

CAT#: SC303602

CRYBA1 (untagged)-Human crystallin, beta A1 (CRYBA1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CRYBA1
• Synonyms: CRYB1; CTRCT10
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_005208, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGACCCAGGCTGAGCAGCAGGAGCTGGAAACCCTTCCAACCACCAAGATGGCTCAGACCAACCCTA
  CGCCGGGGTCCCTGGGGCCATGGAAGATAACCATCTATGATCAGGAGAACTTTCAGGGCAAGAGGATGGA
  GTTCACCAGCTCCTGTCCAAATGTCTCTGAGCGCAGTTTTGATAATGTCCGGTCCCTGAAGGTGGAAAGT
  GGCGCCTGGATTGGTTATGAGCATACCAGCTTCTGTGGGCAACAGTTTATCCTGGAGAGAGGAGAATACC
  CTCGCTGGGATGCCTGGAGTGGGAGTAATGCCTACCACATTGAGCGTCTCATGTCCTTCCGCCCCATCTG
  TTCAGCTAATCATAAGGAGTCTAAGATGACCATCTTTGAGAAGGAAAACTTTATTGGACGCCAGTGGGAG
  ATCTCTGACGACTACCCCTCCTTGCAAGCCATGGGCTGGTTCAACAACGAAGTCGGCTCCATGAAGATAC
  AAAGTGGGGCCTGGGTTTGCTACCAATATCCTGGATATCGTGGGTATCAGTATATCTTGGAATGTGACCA
  TCATGGAGGAGACTATAAACATTGGAGAGAGTGGGGCTCTCATGCCCAGACTTCGCAGATCCAATCGATT
  CGCCGAATCCAACAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_005208
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_005208.4, NP_005199.2
• RefSeq Size: 806 bp
• RefSeq ORF: 648 bp
• Locus ID: 1411
• Cytogenetics: 17q11.2
• Gene Summary: 'Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group, none in the acidic group). Beta-crystallins form aggregates of different sizes and are able to self-associate to form dimers or to form heterodimers with other beta-crystallins. This gene, a beta acidic group member, encodes two proteins (crystallin, beta A3 and crystallin, beta A1) from a single mRNA, the latter protein is 17 aa shorter than crystallin, beta A3 and is generated by use of an alternate translation initiation site. Deletion of exons 3 and 4 causes the autosomal dominant disease 'zonular cataract with sutural opacities'. [provided by RefSeq, Jul 2008]'