HOX11 (TLX1) (NM_005521) Human Untagged Clone

CAT#: SC303659

TLX1 (untagged)-Human T-cell leukemia homeobox 1 (TLX1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TLX1
• Synonyms: HOX11; TCL3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_005521, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCACCTGGGTCCGCACCACCTCCACCCGGGTCACGCAGAGCCCATTAGCTTCGGCATCGACCAGA
  TCCTCAACAGCCCGGACCAGGGTGGCTGCATGGGACCCGCCTCGCGCCTCCAGGACGGAGAATACGGCCT
  TGGCTGCTTGGTCGGAGGCGCCTACACTTACGGCGGCGGGGGCTCCGCGGCCGCGACGGGGGCTGGAGGA
  GCGGGGGCCTATGGTACTGGAGGTCCCGGCGGCCCCGGAGGCCCGGCAGGCGGCGGCGGCGCCTGCAGCA
  TGGGTCCTCTGACCGGCTCCTACAACGTGAACATGGCCTTGGCAGGCGGCCCCGGTCCTGGCGGCGGCGG
  CGGCAGCAGCGGCGGTGCCGGGGCACTCAGCGCTGCGGGGGTAATCCGGGTGCCGGCACACAGGCCGCTC
  GCCGGAGCCGTGGCCCACCCCCAGCCCCTGGCCACCGGCTTGCCCACCGTGCCCTCTGTGCCTGCCATGC
  CGGGCGTCAACAACCTCACTGGCCTCACCTTCCCCTGGATGGAGAGTAACCGCAGATACACAAAGGACAG
  GTTCACAGGTCACCCCTATCAGAACCGGACGCCCCCCAAGAAGAAGAAGCCGCGCACGTCCTTCACACGC
  CTGCAGATCTGCGAGCTGGAGAAGCGCTTCCACCGCCAGAAGTACCTGGCCTCGGCCGAGCGCGCCGCCC
  TGGCCAAGGCGCTCAAAATGACCGATGCGCAGGTCAAAACCTGGTTCCAGAACCGGCGGACAAAGTGGAG
  ACGGCAGACTGCGGAGGAACGGGAGGCCGAGAGGCAGCAAGCGAACCGCATCCTCCTGCAGTTGCAGCAG
  GAGGCCTTCCAGAAGAGCCTGGCACAGCCGCTGCCCGCTGACCCTCTGTGCGTGCACAACTCGTCGCTCT
  TCGCCCTGCAGAATCTGCAGCCGTGGTCTGACGACTCGACCAAAATCACTAGCGTCACGTCGGTGGCGTC
  GGCCTGCGAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_005521
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_005521.3, NP_005512.1
• RefSeq Size: 2123 bp
• RefSeq ORF: 993 bp
• Locus ID: 3195
• Cytogenetics: 10q24.31
• Domains: homeobox
• Gene Summary: 'This gene encodes a nuclear transcription factor that belongs to the NK-linked or NK-like (NKL) subfamily of homeobox genes. The encoded protein is required for normal development of the spleen during embryogenesis. This protein is also involved in specification of neuronal cell fates. Ectopic expression of this gene due to chromosomal translocations is associated with certain T-cell acute lymphoblastic leukemias. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]'
  Transcript Variant: This variant (1) encodes the longest isoform (1).