THG1L (NM_017872) Human Untagged Clone

CAT#: SC304538

THG1L (untagged)-Human tRNA-histidine guanylyltransferase 1-like (S. cerevisiae) (THG1L)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: THG1L
• Synonyms: hTHG1; ICF45; IHG-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_017872, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTGGGGCGCCTGTAAAGTTAAGGTTCACGATTCCTTGGCCACCATTTCCATCACTCTGAGACGGTACC
  TGAGATTGGGGGCGACCATGGCAAAAAGCAAGTTCGAGTACGTGAGGGACTTCGAGGCTGACGACACCTG
  CCTGGCACACTGCTGGGTGGTAGTGCGGCTGGACGGCCGGAATTTCCATCGGTTTGCTGAGAAGCACAAC
  TTTGCAAAACCCAATGACAGCCGTGCTCTCCAGCTGATGACCAAATGTGCGCAGACTGTGATGGAAGAAC
  TAGAGGATATTGTGATCGCGTATGGACAGAGTGATGAGTACAGCTTTGTGTTCAAGCGGAAAACCAATTG
  GTTTAAAAGAAGAGCCAGTAAGTTCATGACTCACGTGGCCTCCCAGTTTGCCTCCAGCTATGTGTTTTAT
  TGGCGGGATTACTTTGAGGACCAGCCCCTTCTGTATCCCCCAGGCTTTGACGGAAGAGTCGTGGTGTATC
  CCAGCAACCAGACTTTAAAGGACTACCTCAGCTGGCGACAAGCAGATTGTCACATCAATAATCTTTATAA
  TACAGTTTTCTGGGCACTTATACAACAATCTGGACTAACACCAGTACAAGCCCAAGGGAGATTACAGGGA
  ACTCTTGCAGCAGACAAGAATGAGATTTTGTTTTCTGAATTCAACATCAACTATAATAATGAGCTGCCGA
  TGTATAGGAAAGGGACTGTGTTGATATGGCAGAAGGTGGATGAAGTGATGACAAAAGAAATTAAGCTGCC
  AACAGAAATGGAAGGAAAAAAGATGGCAGTGACCCGGACCAGGACAAAGCCAGTGCCCTTGCACTGCGAT
  ATCATCGGGGATGCTTTCTGGAAGGAACATCCAGAGATTCTAGATGAAGACAGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_017872
• ORF Size: 897 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_017872.4, NP_060342.2
• RefSeq Size: 2932
• RefSeq ORF: 897
• Locus ID: 54974
• Gene Summary: The protein encoded by this gene is a mitochondrial protein that is induced by high levels of glucose and is associated with diabetic nephropathy. The encoded protein appears to increase mitochondrial biogenesis, which could lead to renal fibrosis. Another function of this protein is that of a guanyltransferase, adding GMP to the 5' end of tRNA(His). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.