IL36 gamma (IL36G) (NM_019618) Human Untagged Clone

CAT#: SC304685

IL36G (untagged)-Human interleukin 1 family, member 9 (IL1F9)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL36G
• Synonyms: IL-1F9; IL-1H1; IL-1RP2; IL1E; IL1F9; IL1H1; IL1RP2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_019618 edited
  ATGAGAGGCACTCCAGGAGACGCTGATGGTGGAGGAAGGGCCGTCTATCAATCAATGTGT
  AAACCTATTACTGGGACTATTAATGATTTGAATCAGCAAGTGTGGACCCTTCAGGGTCAG
  AACCTTGTGGCAGTTCCACGAAGTGACAGTGTGACCCCAGTCACTGTTGCTGTTATCACA
  TGCAAGTATCCAGAGGCTCTTGAGCAAGGCAGAGGGGATCCCATTTATTTGGGAATCCAG
  AATCCAGAAATGTGTTTGTATTGTGAGAAGGTTGGAGAACAGCCCACATTGCAGCTAAAA
  GAGCAGAAGATCATGGATCTGTATGGCCAACCCGAGCCCGTGAAACCCTTCCTTTTCTAC
  CGTGCCAAGACTGGTAGGACCTCCACCCTTGAGTCTGTGGCCTTCCCGGACTGGTTCATT
  GCCTCCTCCAAGAGAGACCAGCCCATCATTCTGACTTCAGAACTTGGGAAGTCATACAAC
  ACTGCCTTTGAATTAAATATAAATGACTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_019618
• ORF Size: 510 bp
• Insert Size: 500
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_019618.2, NP_062564.1
• RefSeq Size: 1180
• RefSeq ORF: 510
• Locus ID: 56300
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: The protein encoded by this gene is a member of the interleukin 1 cytokine family. The activity of this cytokine is mediated by interleukin 1 receptor-like 2 (IL1RL2/IL1R-rp2), and is specifically inhibited by interleukin 1 family, member 5 (IL1F5/IL-1 delta). Interferon-gamma, tumor necrosis factor-alpha and interleukin 1, beta (IL1B) are reported to stimulate the expression of this cytokine in keratinocytes. The expression of this cytokine in keratinocytes can also be induced by a contact hypersensitivity reaction or herpes simplex virus infection. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. [provided by RefSeq, May 2019]
  Transcript Variant: This variant (1) encodes the longer isoform (1).