Achaete scute homolog 3 (ASCL3) (NM_020646) Human Untagged Clone

CAT#: SC304791

ASCL3 (untagged)-Human achaete-scute complex homolog 3 (Drosophila) (ASCL3)


  "NM_020646" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "ASCL3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ASCL3
Synonyms bHLHa42; HASH3; SGN1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_020646 edited
ATGATGGACAACAGAGGCAACTCTAGTCTACCTGACAAACTTCCTATCTTCCCTGATTCT
GCCCGCTTGCCACTGACCAGGTCCTTCTATCTGGAGCCCATGGTCACTTTCCACGTGCAC
CCAGAGGCCCCGGTGTCATCCCCTTACTCTGAGGAGCTGCCACGGCTGCCTTTTCCCAGC
GACTCTCTTATCCTGGGAAATTACAGTGAACCCTGCCCCTTCTCTTTCCCGATGCCTTAT
CCAAATTACAGAGGGTGCGAGTACTCCTACGGGCCAGCCTTCACCCGGAAAAGGAATGAG
CGGGAAAGGCAGCGGGTGAAATGTGTCAATGAAGGCTATGCCCAGCTCCGCCATCATCTG
CCAGAGGAGTATTTGGAGAAGCGACTCAGCAAAGTGGAAACCCTCAGAGCTGCGATCAAG
TACATTAACTACCTGCAGTCTCTTCTGTACCCTGATAAAGCTGAGACCAAGAATAACCCT
GGAAAAGTTTCCTCCATGATAGCAACCACCAGCCACCATGCTGACCCTATGTTCAGAATT
GTTTGA
Restriction Sites Please inquire     
ACCN NM_020646
ORF Size 546 bp
Insert Size 500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_020646.1, NP_065697.1
RefSeq Size 650
RefSeq ORF 546
Locus ID 56676
Gene Summary Basic helix-loop-helix transcription factors, such as ASCL3, are essential for the determination of cell fate and the development and differentiation of numerous tissues (Jonsson et al., 2004 [PubMed 15475265]). [supplied by OMIM, Mar 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.