GH2 (NM_022556) Human Untagged Clone

CAT#: SC305029

GH2 (untagged)-Human growth hormone 2 (GH2), transcript variant 4


  "NM_022556" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GH2
Synonyms GH-V; GHB2; GHL; GHV; hGH-V
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_022556, the custom clone sequence may differ by one or more nucleotides


ATGGCTGCAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGGCCTGCTCTGCCTGTCCTGGCTTCAAGAGG
GCAGTGCCTTCCCAACCATTCCCTTATCCAGGCTTTTTGACAACGCTATGCTCCGCGCCCGTCGCCTGTA
CCAGCTGGCATATGACACCTATCAGGAGTTTAACCCCCAGACCTCCCTCTGCTTCTCAGAGTCTATTCCA
ACACCTTCCAACAGGGTGAAAACGCAGCAGAAATCTAACCTAGAGCTGCTCCGCATCTCCCTGCTGCTCA
TCCAGTCATGGCTGGAGCCCGTGCAGCTCCTCAGGAGCGTCTTCGCCAACAGCCTGGTGTATGGCGCCTC
GGACAGCAACGTCTATCGCCACCTGAAGGACCTAGAGGAAGGCATCCAAACGCTGATGTGGAGGCTGGAA
GATGGCAGCCCCCGGACTGGGCAGATCTTCAATCAGTCCTACAGCAAGTTTGACACAAAATCGCACAACG
ATGACGCACTGCTCAAGAACTACGGGCTGCTCTACTGCTTCAGGAAGGACATGGACAAGGTCGAGACATT
CCTGCGCATCGTGCAGTGCCGCTCTGTGGAGGGCAGCTGTGGCTTCTAG


Restriction Sites SgfI-MluI     
ACCN NM_022556
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_022556.3, NP_072050.1
RefSeq Size 876 bp
RefSeq ORF 609 bp
Locus ID 2689
Cytogenetics 17q23.3
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, Neuroactive ligand-receptor interaction
Gene Summary 'The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones which play an important role in growth control. The gene, along with four other related genes, is located at the growth hormone locus on chromosome 17 where they are interspersed in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. The five genes share a remarkably high degree of sequence identity. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. As in the case of its pituitary counterpart, growth hormone 1, the predominant isoform of this particular family member shows similar somatogenic activity, with reduced lactogenic activity. Mutations in this gene lead to placental growth hormone/lactogen deficiency. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (4) utilizes an alternative splice acceptor site 45 nt into exon 3 to generate the 20-kDa isoform (4) which has an internal deletion relative to the predominant 22-kDa isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.