Growth Hormone (GH1) (NM_022562) Human Untagged Clone

CAT#: SC305033

GH1 (untagged)-Human growth hormone 1 (GH1), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GH1
• Synonyms: GH; GH-N; GHN; hGH-N; IGHD1B
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_022562 edited
  GCAATGGCTACAGAGGCTGGAAGATGGCAGCCCCCGGACTGGGCAGATCTTCAAGCAGAC
  CTACAGCAAGTTCGACACAAACTCACACAACGATGACGCACTACTCAAGAACTACGGGCT
  GCTCTACTGCTTCAGGAAGGACATGGACAAGGTCGAGACATTCCTGCGCATCGTGCAGTG
  CCGCTCTGTGGAGGGCAGCTGTGGCTTCTAGCTGCCCGGGTGGCATCCCTGTGACCCCTC
  CCCAGTGCCTCTCCTGGCCCTGGAAG
  
• Restriction Sites: Please inquire
• ACCN: NM_022562
• Insert Size: 300 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_022562.2.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_022562.2, NP_072056.1
• RefSeq Size: 376 bp
• RefSeq ORF: 93 bp
• Locus ID: 2688
• Cytogenetics: 17q23.3
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, Neuroactive ligand-receptor interaction
• Gene Summary: 'The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones which play an important role in growth control. The gene, along with four other related genes, is located at the growth hormone locus on chromosome 17 where they are interspersed in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. The five genes share a remarkably high degree of sequence identity. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. This particular family member is expressed in the pituitary but not in placental tissue as is the case for the other four genes in the growth hormone locus. Mutations in or deletions of the gene lead to growth hormone deficiency and short stature. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (5) is missing exons 2, 3 and 4, leading to a frameshift that generates the shortest isoform (5). The majority of the sequence encoding the signal peptide is missing, including the signal cleavage site. The carboxy terminus of this isoform (5) is unique among all other GH1 isoforms.