U1SNRNPBP (SNRNP35) (NM_022717) Human Untagged Clone

CAT#: SC305045

SNRNP35 (untagged)-Human small nuclear ribonucleoprotein 35kDa (U11/U12) (SNRNP35), transcript variant 2


  "NM_022717" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SNRNP35"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SNRNP35
Synonyms HM-1; U1SNRNPBP
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_022717, the custom clone sequence may differ by one or more nucleotides
ATGAACGATTGGATGCCCATCGCCAAGGAGTATGATCCACTCAAAGCGGGCAGCATTGAT
GGCACCGATGAAGACCCACACGACCGCGCGGTCTGGAGGGCAATGCTGGCACGATATGTC
CCCAACAAAGGTGTCATAGGAGATCCCCTCCTCACCCTGTTTGTGGCCAGACTAAACTTG
CAGACCAAGGAGGACAAATTAAAGGAAGTCTTTTCCCGCTATGGTGACATCCGGCGGCTT
CGGCTGGTCAGGGACTTGGTCACAGGTTTTTCAAAGGGCTACGCCTTCATCGAATACAAG
GAGGAGCGTGCCGTGATCAAAGCTTACCGAGATGCTGATGGCCTGGTTATTGACCAGCAT
GAGATATTTGTGGACTACGAGCTGGAAAGGACTCTCAAAGGGTGGATCCCTCGGCGACTT
GGAGGCGGTCTTGGGGGAAAAAAGGAGTCTGGGCAACTGAGATTTGGGGGACGGGACCGG
CCTTTTCGAAAACCTATTAACTTGCCAGTTGTTAAAAACGACCTCTATAGAGAGGGAAAA
CGGGAAAGGCGGGAGCGATCTCGATCCCGAGAAAGACACTGGGACTCGAGGACAAGGGAT
CGAGACCATGACAGGGGCCGGGAGAAGAGATGGCAAGAAAGAGAGCCGACCAGGGTGTGG
CCCGACAATGACTGGGAGAGAGAGAGGGACTTCAGAGATGACAGGATCAAGGGGAGGGAG
AAGAAGGAAAGAGGCAAGTAG
Restriction Sites Please inquire     
ACCN NM_022717
ORF Size 741 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_022717.2, NP_073208.1
RefSeq Size 967
RefSeq ORF 741
Locus ID 11066
Gene Summary The protein encoded by this gene is a homolog of the U1-snRNP binding protein. The N-terminal half contains a RNA recognition motif and the C-terminal half is rich in Arg/Asp and Arg/Glu dipeptides, which is a characteristic of a variety of splicing factors. This protein is a component of the U11/U12 small nuclear ribonucleoproteins (snRNP) that form part of the U12-type spliceosome. Alternative splicing results in multiple transcript variants encoding two distinct isoforms and representing a non-protein coding variant. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (2) encodes the shorter isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.