Wilms Tumor Protein (WT1) (NM_024425) Human Untagged Clone

CAT#: SC305117

WT1 (untagged)-Human Wilms tumor 1 (WT1), transcript variant C


  "NM_024425" in other vectors (4)

Reconstitution Protocol

USD 840.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol WT1
Synonyms AWT1; GUD; WAGR; Wilms tumor 1; WIT-2; WT33
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_024425 edited
CTGCAGGACCCGGCTTCCACGTGTGTCCCGGAGCCGGCGTCTCAGCACACGCTCCGCTCC
GGGCCTGGGTGCCTACAGCAGCCAGAGCAGCAGGGAGTCCGGGACCCGGGCGGCATCTGG
GCCAAGTTAGGCGCCGCCGAGGCCAGCGCTGAACGTCTCCAGGGCCGGAGGAGCCGCGGG
GCGTCCGGGTCTGAGCCGCAGCAAATGGGCTCCGACGTGCGGGACCTGAACGCGCTGCTG
CCCGCCGTCCCCTCCCTGGGTGGCGGCGGCGGCTGTGCCCTGCCTGTGAGCGGCGCGGCG
CAGTGGGCGCCGGTGCTGGACTTTGCGCCTCCGGGCGCTTCGGCTTACGGGTCGTTGGGC
GGCCCCGCGCCGCCACCGGCTCCGCCGCCACCCCCGCCGCCGCCGCCTCACTCCTTCATC
AAACAGGAGCCGAGCTGGGGCGGCGCGGAGCCGCACGAGGAGCAGTGCCTGAGCGCCTTC
ACTGTCCACTTTTCCGGCCAGTTCACTGGCACAGCCGGAGCCTGTCGCTACGGGCCCTTC
GGTCCTCCTCCGCCCAGCCAGGCGTCATCCGGCCAGGCCAGGATGTTTCCTAACGCGCCC
TACCTGCCCAGCTGCCTCGAGAGCCAGCCCGCTATTCGCAATCAGGGTTACAGCACGGTC
ACCTTCGACGGGACGCCCAGCTACGGTCACACGCCCTCGCACCATGCGGCGCAGTTCCCC
AACCACTCATTCAAGCATGAGGATCCCATGGGCCAGCAGGGCTCGCTGGGTGAGCAGCAG
TACTCGGTGCCGCCCCCGGTCTATGGCTGCCACACCCCCACCGACAGCTGCACCGGCAGC
CAGGCTTTGCTGCTGAGGACGCCCTACAGCAGTGACAATTTATACCAAATGACATCCCAG
CTTGAATGCATGACCTGGAATCAGATGAACTTAGGAGCCACCTTAAAGGGCCACAGCACA
GGGTACGAGAGCGATAACCACACAACGCCCATCCTCTGCGGAGCCCAATACAGAATACAC
ACGCACGGTGTCTTCAGAGGCATTCAGGATGTGCGGCGTGTGCCTGGAGTAGCCCCGACT
CTTGTACGGTCGGCATCTGAGACCAGTGAGAAACGCCCCTTCATGTGTGCTTACCCAGGC
TGCAATAAGAGATATTTTAAGCTGTCCCACTTACAGATGCACAGCAGGAAGCACACTGGT
GAGAAACCATACCAGTGTGACTTCAAGGACTGTGAACGAAGGTTTTCTCGTTCAGACCAG
CTCAAAAGACACCAAAGGAGACATACAGGTGTGAAACCATTCCAGTGTAAAACTTGTCAG
CGAAAGTTCTCCCGGTCCGACCACCTGAAGACCCACACCAGGACTCATACAGGTAAAACA
AGTGAAAAGCCCTTCAGCTGTCGGTGGCCAAGTTGTCAGAAAAAGTTTGCCCGGTCAGAT
GAATTAGTCCGCCATCACAACATGCATCAGAGAAACATGACCAAACTCCAGCTGGCGCTT
TGA
Restriction Sites Please inquire     
ACCN NM_024425
Insert Size 3000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_024425.2, NP_077743.2
RefSeq Size 2978 bp
RefSeq ORF 1503 bp
Locus ID 7490
Cytogenetics 11p13
Protein Families Druggable Genome, Transcription Factors
Gene Summary 'This gene encodes a transcription factor that contains four zinc-finger motifs at the C-terminus and a proline/glutamine-rich DNA-binding domain at the N-terminus. It has an essential role in the normal development of the urogenital system, and it is mutated in a small subset of patients with Wilms tumor. This gene exhibits complex tissue-specific and polymorphic imprinting pattern, with biallelic, and monoallelic expression from the maternal and paternal alleles in different tissues. Multiple transcript variants have been described. In several variants, there is evidence for the use of a non-AUG (CUG) translation initiation codon upstream of, and in-frame with the first AUG. Authors of PMID:7926762 also provide evidence that WT1 mRNA undergoes RNA editing in human and rat, and that this process is tissue-restricted and developmentally regulated. [provided by RefSeq, Mar 2015]'
Transcript Variant: This variant (C) lacks exon 5 but contains the additional sequence (encoding KTS) at the end of exon 9. It maintains the same reading frame and encodes an isoform (C) that is 17 aa shorter than the longest WT1 isoform (D). This variant initiates translation from a non-AUG (CUG) site, and also from a downstream, in-frame AUG.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.