LIM2 (NM_030657) Human Untagged Clone

CAT#: SC305278

LIM2 (untagged)-Human lens intrinsic membrane protein 2, 19kDa (LIM2), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LIM2
• Synonyms: CTRCT19; MP17; MP19
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_030657, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTACAGCTTCATGGGTGGTGGCCTGTTCTGTGCCTGGGTGGGGACCATCCTCCTGGTGGTGGCCATGG
  CAACAGACCACTGGATGCAGTACCGGCTGTCAGGGTCCTTCGCCCACCAGGGCCTGTGGCGGTACTGCCT
  GGGCAACAAGTGCTACCTGCAGACAGACAGCATCGGTGAGCCCCCCGGCCAGGGTCCAGGCCGCGCCTGG
  GGAAAGAGCAGGGCGGACCTCGGGGCCCAAGGACACCTGTATTCCAGATGGAGAACTCTGCGGCTCAAAG
  AGGGAAAGGGAGCAACCCAAGCATACTGGAATGCCACCCGGGCCTTCATGATCCTGTCTGCCCTATGCGC
  CATCTCCGGCATCATCATGGGCATCATGGCCTTCGCTCATCAGCCTACCTTCTCCCGCATCTCCCGGCCC
  TTCTCTGCTGGCATCATGTTTTTTTCCTCAACCCTTTTCGTCGTGTTGGCCTTGGCCATCTACACTGGAG
  TCACCGTCAGCTTCCTGGGCCGCCGCTTTGGGGACTGGCGCTTTTCCTGGTCCTACATCCTGGGCTGGGT
  GGCAGTGCTCATGACGTTCTTCGCAGGGATTTTCTACATGTGCGCCTACCGGGTGCATGAATGCCGGCGC
  CTGTCTACACCCCGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_030657
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_030657.3, NP_085915.2
• RefSeq Size: 1001 bp
• RefSeq ORF: 648 bp
• Locus ID: 3982
• Cytogenetics: 19q13.41
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: 'This gene encodes an eye lens-specific protein found at the junctions of lens fiber cells, where it may contribute to cell junctional organization. It acts as a receptor for calmodulin, and may play an important role in both lens development and cataractogenesis. Mutations in this gene have been associated with cataract formation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]'
  Transcript Variant: This variant (1) encodes the longer isoform (1).