PLA2G12B (NM_032562) Human Untagged Clone

CAT#: SC305474

PLA2G12B (untagged)-Human phospholipase A2, group XIIB (PLA2G12B)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PLA2G12B
• Synonyms: FKSG71; GXIIB; GXIIIsPLA2; PLA2G13; sPLA2-GXIIB
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_032562, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGCTGGCCAGTGGCTTCTTGGTTTTGTGGCTCAGCCTTGGGGGTGGCCTGGCTCAGAGCGACACGA
  GCCCTGACACGGAGGAGTCCTATTCAGACTGGGGCCTTCGGCACCTCCGGGGAAGCTTTGAATCCGTCAA
  TAGCTACTTCGATTCTTTTCTGGAGCTGCTGGGAGGGAAGAATGGAGTCTGTCAGTACAGGTGCCGATAT
  GGAAAGGCACCAATGCCCAGACCTGGCTACAAGCCCCAAGAGCCCAATGGCTGCGGCTCCTATTTCCTGG
  GTCTCAAGGTACCAGAAAGTATGGACTTGGGCATTCCAGCAATGACAAAGTGCTGCAACCAGCTGGATGT
  CTGTTATGACACTTGCGGTGCCAACAAATATCGCTGTGATGCAAAATTCCGATGGTGTCTCCACTCGATC
  TGCTCTGACCTTAAGCGGAGTCTGGGCTTTGTCTCCAAAGTGGAAGCAGCCTGTGATTCCCTGGTTGACA
  CTGTGTTCAACACCGTGTGGACCTTGGGCTGCCGCCCCTTTATGAATAGTCAGCGGGCAGCTTGCATCTG
  TGCAGAGGAGGAGAAGGAAGAGTTATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_032562
• ORF Size: 588 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_032562.4, NP_115951.2
• RefSeq Size: 1577
• RefSeq ORF: 588
• Locus ID: 84647
• Protein Families: Secreted Protein
• Protein Pathways: alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway
• Gene Summary: The protein encoded by this gene belongs to the phospholipase A2 (PLA2) group of enzymes, which function in glycolipid hydrolysis with the release of free fatty acids and lysophospholipids. This family member has altered phospholipid-binding properties and is catalytically inactive. The protein is secreted, and together with microsomal triglyceride transfer protein, it functions to regulate HNF4alpha-induced hepatitis C virus infectivity. The expression of this gene is down-regulated in various tumors, suggesting that it may function as a negative regulator of tumor progression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a).