PLA2G12B (NM_032562) Human Untagged Clone
CAT#: SC305474
PLA2G12B (untagged)-Human phospholipase A2, group XIIB (PLA2G12B)
"NM_032562" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PLA2G12B |
Synonyms | FKSG71; GXIIB; GXIIIsPLA2; PLA2G13; sPLA2-GXIIB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_032562, the custom clone sequence may differ by one or more nucleotides
ATGAAGCTGGCCAGTGGCTTCTTGGTTTTGTGGCTCAGCCTTGGGGGTGGCCTGGCTCAGAGCGACACGA GCCCTGACACGGAGGAGTCCTATTCAGACTGGGGCCTTCGGCACCTCCGGGGAAGCTTTGAATCCGTCAA TAGCTACTTCGATTCTTTTCTGGAGCTGCTGGGAGGGAAGAATGGAGTCTGTCAGTACAGGTGCCGATAT GGAAAGGCACCAATGCCCAGACCTGGCTACAAGCCCCAAGAGCCCAATGGCTGCGGCTCCTATTTCCTGG GTCTCAAGGTACCAGAAAGTATGGACTTGGGCATTCCAGCAATGACAAAGTGCTGCAACCAGCTGGATGT CTGTTATGACACTTGCGGTGCCAACAAATATCGCTGTGATGCAAAATTCCGATGGTGTCTCCACTCGATC TGCTCTGACCTTAAGCGGAGTCTGGGCTTTGTCTCCAAAGTGGAAGCAGCCTGTGATTCCCTGGTTGACA CTGTGTTCAACACCGTGTGGACCTTGGGCTGCCGCCCCTTTATGAATAGTCAGCGGGCAGCTTGCATCTG TGCAGAGGAGGAGAAGGAAGAGTTATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_032562 |
ORF Size | 588 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_032562.4, NP_115951.2 |
RefSeq Size | 1577 |
RefSeq ORF | 588 |
Locus ID | 84647 |
Protein Families | Secreted Protein |
Protein Pathways | alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway |
Gene Summary | The protein encoded by this gene belongs to the phospholipase A2 (PLA2) group of enzymes, which function in glycolipid hydrolysis with the release of free fatty acids and lysophospholipids. This family member has altered phospholipid-binding properties and is catalytically inactive. The protein is secreted, and together with microsomal triglyceride transfer protein, it functions to regulate HNF4alpha-induced hepatitis C virus infectivity. The expression of this gene is down-regulated in various tumors, suggesting that it may function as a negative regulator of tumor progression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210905 | PLA2G12B (Myc-DDK-tagged)-Human phospholipase A2, group XIIB (PLA2G12B) |
USD 98.00 |
|
RG210905 | PLA2G12B (GFP-tagged) - Human phospholipase A2, group XIIB (PLA2G12B) |
USD 460.00 |
|
RC210905L1 | Lenti ORF clone of Human phospholipase A2, group XIIB (PLA2G12B), Myc-DDK-tagged |
USD 768.00 |
|
RC210905L2 | Lenti ORF clone of Human phospholipase A2, group XIIB (PLA2G12B), mGFP tagged |
USD 620.00 |
|
RC210905L3 | Lenti ORF clone of Human phospholipase A2, group XIIB (PLA2G12B), Myc-DDK-tagged |
USD 620.00 |
|
RC210905L4 | Lenti ORF clone of Human phospholipase A2, group XIIB (PLA2G12B), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review