Caveolin 3 (CAV3) (NM_033337) Human Untagged Clone
CAT#: SC305616
CAV3 (untagged)-Human caveolin 3 (CAV3), transcript variant 1
"NM_033337" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CAV3 |
| Synonyms | LGMD1C; LQT9; MPDT; RMD2; VIP-21; VIP21 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_033337 edited
CGATGATGGCAGAAGAGCACACAGATCTCGAGGCCCAGATCGTCAAGGATATCCACTGCA AGGAGATTGACCTGGTGAACCGAGACCCCAAGAACATTAACGAGGACATAGTCAAGGTGG ATTTTGAAGACGTGATCGCAGAGCCTGTGGGCACCTACAGCTTTGACGGCGTGTGGAAGG TGAGCTACACCACCTTCACTGTCTCCAAGTACTGGTGCTACCGTCTGTTGTCCACGCTGC TGGGCGTCCCACTGGCCCTGCTCTGGGGCTTCCTGTTCGCCTGCATCTCCTTCTGCCACA TCTGGGCGGTGGTGCCATGCATTAAGAGCTACCTGATCGAGATCCAGTGCATCAGCCACA TCTACTCACTCTGCATCCGCACCTTCTGCAACCCACTCTTCGCGGCCCTGGGCCAGGTCT GCAGCAGCATCAAGGTGGTGCTGCGGAAGGAGGTCTAAAGCCAGGTGGGGCAACAGCGGT GGCAGGGCAGGGGGTGGTGGGCCAGACTGGTCCCCGGGGGACTTCTTCACAGGGGCTGCT GGCGAGCTCTTTCTCTTTAGGGACTGCTCCATACCCCATGATGGAGCACACGGTGTAGGG AAGCCAGAAAGAAAAGA |
| Restriction Sites | Please inquire |
| ACCN | NM_033337 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_033337.1. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_033337.1, NP_203123.1 |
| RefSeq Size | 1425 bp |
| RefSeq ORF | 456 bp |
| Locus ID | 859 |
| Cytogenetics | 3p25.3 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Focal adhesion |
| Gene Summary | 'This gene encodes a caveolin family member, which functions as a component of the caveolae plasma membranes found in most cell types. Caveolin proteins are proposed to be scaffolding proteins for organizing and concentrating certain caveolin-interacting molecules. Mutations identified in this gene lead to interference with protein oligomerization or intra-cellular routing, disrupting caveolae formation and resulting in Limb-Girdle muscular dystrophy type-1C (LGMD-1C), hyperCKemia or rippling muscle disease (RMD). Alternative splicing has been identified for this locus, with inclusion or exclusion of a differentially spliced intron. In addition, transcripts utilize multiple polyA sites and contain two potential translation initiation sites. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (1) is longer than variant 2, since it includes a differentially spliced intron located in the 3' UTR, but both transcripts encode identical proteins. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221140 | CAV3 (Myc-DDK-tagged)-Human caveolin 3 (CAV3), transcript variant 1 |
USD 150.00 |
|
| RG221140 | CAV3 (GFP-tagged) - Human caveolin 3 (CAV3), transcript variant 1 |
USD 460.00 |
|
| RC221140L1 | Lenti ORF clone of Human caveolin 3 (CAV3), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
| RC221140L2 | Lenti ORF clone of Human caveolin 3 (CAV3), transcript variant 1, mGFP tagged |
USD 620.00 |
|
| RC221140L3 | Lenti ORF clone of Human caveolin 3 (CAV3), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
| RC221140L4 | Lenti ORF clone of Human caveolin 3 (CAV3), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China