CIB3 (NM_054113) Human Untagged Clone

CAT#: SC305734

CIB3 (untagged)-Human calcium and integrin binding family member 3 (CIB3)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CIB3
• Synonyms: KIP3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_054113, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCAACAAGCAGACAGTCTTCACACACGAGCAGCTGGAAGCGTATCAGGACTGCACATTTTTCACAA
  GGAAGGAGATCATGAGGCTCTTCTATCGCTACCAGGACCTGGCCCCACAGCTCGTGCCCCTCGACTATAC
  CACCTGCCCCGATGTGAAGGTGCCCTACGAGCTCATTGGCAGCATGCCCGAGCTGAAGGACAACCCCTTC
  CGCCAGAGGATTGCCCAGGTATTCTCTGAGGATGGGGATGGCCACATGACCCTGGACAACTTTTTGGACA
  TGTTTTCCGTGATGAGTGAAATGGCTCCCCGCGACCTCAAGGCTTACTATGCTTTTAAAATTTATGATTT
  TAACAACGACGACTACATTTGTGCGTGGGACCTGGAGCAGACGGTGACCAAACTGACGCGGGGGGGGCTG
  AGTGCCGAGGAGGTGAGCCTGGTATGTGAGAAGGTGCTGGATGAGGCTGATGGAGACCATGATGGGCGGC
  TGTCCCTGGAAGATTTCCAGAACATGATCCTCCGGGCACCAGACTTCCTCAGCACCTTCCACATCCGAAT
  CTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_054113
• ORF Size: 564 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_054113.3, NP_473454.1
• RefSeq Size: 725
• RefSeq ORF: 564
• Locus ID: 117286
• Protein Families: Druggable Genome
• Gene Summary: This gene product shares a high degree of sequence similarity with DNA-dependent protein kinase catalytic subunit-interacting protein 2 in human and mouse, and like them may bind the catalytic subunit of DNA-dependent protein kinases. The exact function of this gene is not known. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).