MADCAM1 (NM_130760) Human Untagged Clone
CAT#: SC305894
MADCAM1 (untagged)-Human mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 1
"NM_130760" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MADCAM1 |
Synonyms | MACAM1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_130760, the custom clone sequence may differ by one or more nucleotides
ATGGATTTCGGACTGGCCCTCCTGCTGGCGGGGCTTCTGGGGCTCCTCCTCGGCCAGTCCCTCCAGGTGA AGCCCCTGCAGGTGGAGCCCCCGGAGCCGGTGGTGGCCGTGGCCTTGGGCGCCTCGCGCCAGCTCACCTG CCGCCTGGCCTGCGCGGACCGCGGGGCCTCGGTGCAGTGGCGGGGCCTGGACACCAGCCTGGGCGCGGTG CAGTCGGACACGGGCCGCAGCGTCCTCACCGTGCGCAACGCCTCGCTGTCGGCGGCCGGGACCCGCGTGT GCGTGGGCTCCTGCGGGGGCCGCACCTTCCAGCACACCGTGCAGCTCCTTGTGTACGCCTTCCCGGACCA GCTGACCGTCTCCCCAGCAGCCCTGGTGCCTGGTGACCCGGAGGTGGCCTGTACGGCCCACAAAGTCACG CCCGTGGACCCCAACGCGCTCTCCTTCTCCCTGCTCGTCGGGGGCCAGGAACTGGAGGGGGCGCAAGCCC TGGGCCCGGAGGTGCAGGAGGAGGAGGAGGAGCCCCAGGGGGACGAGGACGTGCTGTTCAGGGTGACAGA GCGCTGGCGGCTGCCGCCCCTGGGGACCCCTGTCCCGCCCGCCCTCTACTGCCAGGCCACGATGAGGCTG CCTGGCTTGGAGCTCAGCCACCGCCAGGCCATCCCCGTCCTGCACAGCCCGACCTCCCCGGAGCCTCCCG ACACCACCTCCCCGGAGTCTCCCGACACCACCTCCCCGGAGTCTCCCGACACCACCTCCCAGGAGCCTCC CGACACCACCTCCCCGGAGCCTCCCGACAAGACCTCCCCGGAGCCCGCCCCCCAGCAGGGCTCCACACAC ACCCCCAGGAGCCCAGGCTCCACCAGGACTCGCCGCCCTGAGATCTCCCAGGCTGGGCCCACGCAGGGAG AAGTGATCCCAACAGGCTCGTCCAAACCTGCGGGTGACCAGCTGCCCGCGGCTCTGTGGACCAGCAGTGC GGTGCTGGGACTGCTGCTCCTGGCCTTGCCCACCTATCACCTCTGGAAACGCTGCCGGCACCTGGCTGAG GACGACACCCACCCACCAGCTTCTCTGAGGCTTCTGCCCCAGGTGTCGGCCTGGGCTGGGTTAAGGGGGA CCGGCCAGGTCGGGATCAGCCCCTCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_130760 |
ORF Size | 1149 bp |
Insert Size | 1500 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_130760.2, NP_570116.2 |
RefSeq Size | 1546 |
RefSeq ORF | 1149 |
Locus ID | 8174 |
Protein Pathways | Cell adhesion molecules (CAMs) |
Gene Summary | The protein encoded by this gene is an endothelial cell adhesion molecule that interacts preferentially with the leukocyte beta7 integrin LPAM-1 (alpha4beta7), L-selectin, and VLA-4 (alpha4beta1) on myeloid cells to direct leukocytes into mucosal and inflamed tissues. It is a member of the immunoglobulin family and is similar to ICAM1 and VCAM1. At least seven alternatively spliced transcripts encoding different protein isoforms have been found for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) is the longer, predominant transcript and encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219060 | MADCAM1 (Myc-DDK-tagged)-Human mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 1 |
USD 420.00 |
|
RG219060 | MADCAM1 (GFP-tagged) - Human mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 1 |
USD 460.00 |
|
RC219060L1 | Lenti ORF clone of Human mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC219060L2 | Lenti ORF clone of Human mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC219060L3 | Lenti ORF clone of Human mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC219060L4 | Lenti ORF clone of Human mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review