Plunc (BPIFA1) (NM_130852) Human Untagged Clone

CAT#: SC305921

BPIFA1 (untagged)-Human palate, lung and nasal epithelium associated (PLUNC), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BPIFA1
• Synonyms: bA49G10.5; LUNX; NASG; PLUNC; SPLUNC1; SPURT
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_130852, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTTCAAACTGGGGGCCTCATTGTCTTCTACGGGCTGTTAGCCCAGACCATGGCCCAGTTTGGAGGCC
  TGCCCGTGCCCCTGGACCAGACCCTGCCCTTGAATGTGAATCCAGCCCTGCCCTTGAGTCCCACAGGTCT
  TGCAGGAAGCTTGACAAATGCCCTCAGCAATGGCCTGCTGTCTGGGGGCCTGTTGGGCATTCTGGAAAAC
  CTTCCGCTCCTGGACATCCTGAAGCCTGGAGGAGGTACTTCTGGTGGCCTCCTTGGGGGACTGCTTGGAA
  AAGTGACGTCAGTGATTCCTGGCCTGAACAACATCATTGACATAAAGGTCACTGACCCCCAGCTGCTGGA
  ACTTGGCCTTGTGCAGAGCCCTGATGGCCACCGTCTCTATGTCACCATCCCTCTCGGCATAAAGCTCCAA
  GTGAATACGCCCCTGGTCGGTGCAAGTCTGTTGAGGCTGGCTGTGAAGCTGGACATCACTGCAGAAATCT
  TAGCTGTGAGAGATAAGCAGGAGAGGATCCACCTGGTCCTTGGTGACTGCACCCATTCCCCTGGAAGCCT
  GCAAATTTCTCTGCTTGATGGACTTGGCCCCCTCCCCATTCAAGGTCTTCTGGACAGCCTCACAGGGATC
  TTGAATAAAGTCCTGCCTGAGTTGGTTCAGGGCAACGTGTGCCCTCTGGTCAATGAGGTTCTCAGAGGCT
  TGGACATCACCCTGGTGCATGACATTGTTAACATGCTGATCCACGGACTACAGTTTGTCATCAAGGTCTA
  A
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_130852
• ORF Size: 771 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_130852.2, NP_570913.1
• RefSeq Size: 1090
• RefSeq ORF: 771
• Locus ID: 51297
• Protein Families: Secreted Protein
• Gene Summary: This gene is the human homolog of murine plunc, and like the mouse gene, is specifically expressed in the upper airways and nasopharyngeal regions. The encoded antimicrobial protein displays antibacterial activity against Gram-negative bacteria. It is thought to be involved in inflammatory responses to irritants in the upper airways and may also serve as a potential molecular marker for detection of micrometastasis in non-small-cell lung cancer. Multiple transcript variants resulting from alternative splicing in the 3' UTR have been detected, but the full-length nature of only three are known. [provided by RefSeq, Aug 2014]
  Transcript Variant: This variant (2) represents the longest transcript. All three variants encode the same protein.