PRSS21 (NM_144957) Human Untagged Clone

CAT#: SC306198

PRSS21 (untagged)-Human protease, serine, 21 (testisin) (PRSS21), transcript variant 3


  "NM_144957" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PRSS21"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PRSS21
Synonyms ESP-1; ESP1; TEST1; TESTISIN
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_144957, the custom clone sequence may differ by one or more nucleotides


ATGGGCGCGCGCGGGGCGCTGCTGCTGGCGCTGCTGCTGGCTCGGGCTGGACTCAGGAAGCCGGAGTCGC
AGGAGGCGGCGCCGTTATCAGGACCATGCGGCCGACGGGTCATCACGTCGCGCATCGTGGGTGGAGAGGA
CGCCGAACTCGGGCGTTGGCCGTGGCAGGGGAGCCTGCGCCTGTGGGATTCCCACGTATGCGGAGTGAGC
CTGCTCAGCCACCGCTGGGCACTCACGGCGGCGCACTGCTTTGAAACCTATAGTGACCTTAGTGATCCCT
CCGGGTGGATGGTCCAGTTTGGCCAGCTGACTTCCATGCCATCCTTCTGGAGCCTGCAGGCCTACTACAC
CCGTTACTTCGTATCGAATATCTATCTGAGCCCTCGCTACCTGGGGAATTCACCCTATGACATTGCCTTG
GTGAAGCTGTCTGCACCTGTCACCTACACTAAACACATCCAGCCCATCTGTCTCCAGGCCTCCACATTTG
AGTTTGAGAACCGGACAGACTGCTGGGTGACTGGCTGGGGGTACATCAAAGAGGATGAGGCACTGCCATC
TCCCCACACCCTCCAGGAAGTTCAGGTCGCCATCATAAACAACTCTATGTGCAACCACCTCTTCCTCAAG
TACAGTTTCCGCAAGGACATCTTTGGAGACATGGGTGACTCAGGTGGACCCTTGGCCTGTAACAAGAATG
GACTGTGGTATCAGATTGGAGTCGTGAGCTGGGGAGTGGGCTGTGGTCGGCCCAATCGGCCCGGTGTCTA
CACCAATATCAGCCACCACTTTGAGTGGATCCAGAAGCTGATGGCCCAGAGTGGCATGTCCCAGCCAGAC
CCCTCCTGGCCGCTACTCTTTTTCCCTCTTCTCTGGGCTCTCCCACTCCTGGGGCCGGTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_144957
ORF Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_144957.2, NP_659206.1
RefSeq Size 1126
RefSeq ORF 903
Locus ID 10942
Protein Families Druggable Genome
Gene Summary This gene encodes a cell-surface anchored serine protease, which is a member of the trypsin family of serine proteases. The encoded protein is predicted to be active on peptide linkages involving the carboxyl group of lysine or arginine. The encoded protein localizes to the cytoplasm and the plasma membrane of premeiotic testicular germ cells and may be involved in progression of testicular tumors of germ cell origin. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.