PIG3 (TP53I3) (NM_147184) Human Untagged Clone

CAT#: SC306303

TP53I3 (untagged)-Human tumor protein p53 inducible protein 3 (TP53I3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TP53I3
• Synonyms: PIG3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_147184, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTAGCCGTGCACTTTGACAAGCCGGGAGGACCGGAAAACCTCTACGTGAAGGAGGTGGCCAAGCCGA
  GCCCGGGGGAGGGTGAAGTCCTCCTGAAGGTGGCGGCCAGCGCCCTGAACCGGGCGGACTTAATGCAGAG
  ACAAGGCCAGTATGACCCACCTCCAGGAGCCAGCAACATTTTGGGACTTGAGGCATCTGGACATGTGGCA
  GAGCTGGGGCCTGGCTGCCAGGGACACTGGAAGATCGGGGACACAGCCATGGCTCTGCTCCCCGGTGGGG
  GCCAGGCTCAGTACGTCACTGTCCCCGAAGGGCTCCTCATGCCTATCCCAGAGGGATTGACCCTGACCCA
  GGCTGCAGCCATCCCAGAGGCCTGGCTCACCGCCTTCCAGCTGTTACATCTTGTGGGAAATGTTCAGGCT
  GGAGACTATGTGCTAATCCATGCAGGACTGAGTGGTGTGGGCACAGCTGCTATCCAACTCACCCGGATGG
  CTGGAGCTATTCCTCTGGTCACAGCTGGCTCCCAGAAGAAGCTTCAAATGGCAGAAAAGCTTGGAGCAGC
  TGCTGGATTCAATTACAAAAAAGAGGATTTCTCTGAAGCAACGCTGAAATTCACCAAAGGTGCTGGAGTT
  AATCTTATTCTAGACTGCATAGGCGGATCCTACTGGGAGAAGAACGTCAACTGCCTGGCTCTTGATGGTC
  GATGGGTTCTCTATGGTCTGATGGGAGGAGGTGACATCAATGGGCCCCTGTTTTCAAAGCTACTTTTTAA
  GCGAGGAAGTCTGATCACCAGTTTGCTGAGGTCTAGGGACAATAAGTACAAGCAAATGCTGGTGAATGCT
  TTCACGGAGCAAATTCTGCCTCACTTCTCCACGGAGGGCCCCCAACGTCTGCTGCCGGTTCTGGACAGAA
  TCTACCCAGTGACCGAAATCCAGGAGGCCCATAAGTACATGGAGGCCAACAAGAACATAGGCAAGATCGT
  CCTGGAACTGCCCCAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_147184
• ORF Size: 999 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_147184.3, NP_671713.1
• RefSeq Size: 1643
• RefSeq ORF: 999
• Locus ID: 9540
• Protein Families: Druggable Genome
• Protein Pathways: p53 signaling pathway
• Gene Summary: The protein encoded by this gene is similar to oxidoreductases, which are enzymes involved in cellular responses to oxidative stresses and irradiation. This gene is induced by the tumor suppressor p53 and is thought to be involved in p53-mediated cell death. It contains a p53 consensus binding site in its promoter region and a downstream pentanucleotide microsatellite sequence. P53 has been shown to transcriptionally activate this gene by interacting with the downstream pentanucleotide microsatellite sequence. The microsatellite is polymorphic, with a varying number of pentanucleotide repeats directly correlated with the extent of transcriptional activation by p53. It has been suggested that the microsatellite polymorphism may be associated with differential susceptibility to cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
  Transcript Variant: This variant (2) differs in the 5'UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1).