NPB (NM_148896) Human Untagged Clone

CAT#: SC306326

NPB (untagged)-Human neuropeptide B (NPB)


  "NM_148896" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NPB
Synonyms L7; PPL7; PPNPB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_148896, the custom clone sequence may differ by one or more nucleotides


ATGGCCCGGTCCGCGACACTGGCGGCCGCCGCCCTGGCGCTGTGCCTGCTGCTGGCGCCGCCTGGCCTCG
CGTGGTACAAGCCAGCGGCGGGGCACAGCTCCTACTCGGTGGGCCGCGCCGCGGGGCTGCTGTCCGGCCT
CCGCAGGTCCCCGTACGCGCGGCGCTCCCAGCCCTACAGAGGGGCGGAACCCCCGGGCGGGGCCGGCGCC
TCCCCGGAGCTGCAACTGCACCCCAGGCTGCGGAGCCTCGCTGTGTGCGTCCAGGACGTCGCCCCAAACC
TGCAGAGGTGCGAGCGGCTCCCCGACGGCCGCGGGACCTACCAGTGCAAGGCGAACGTCTTCCTGTCCCT
GCGCGCAGCCGACTGCCTCGCCGCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_148896
ORF Size 378 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_148896.4, NP_683694.1
RefSeq Size 721
RefSeq ORF 378
Locus ID 256933
Protein Families Secreted Protein, Transmembrane
Gene Summary This gene encodes a member of the neuropeptide B/W family of proteins and preproprotein that is proteolytically processed to generate multiple protein products. The encoded products include neuropeptide B-23 and a C-terminally extended form, neuropeptide B-29, which are characterized by an N-terminal brominated tryptophan amino acid. Both of the encoded peptides bind with higher affinity to neuropeptide B/W (NPB/W) receptor 1 compared to the related NPB/W receptor 2. These peptides may regulate feeding, pain perception, and stress in rodents. [provided by RefSeq, Jul 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.