NPB (NM_148896) Human Untagged Clone
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NPB |
Synonyms | L7; PPL7; PPNPB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_148896, the custom clone sequence may differ by one or more nucleotides
ATGGCCCGGTCCGCGACACTGGCGGCCGCCGCCCTGGCGCTGTGCCTGCTGCTGGCGCCGCCTGGCCTCG CGTGGTACAAGCCAGCGGCGGGGCACAGCTCCTACTCGGTGGGCCGCGCCGCGGGGCTGCTGTCCGGCCT CCGCAGGTCCCCGTACGCGCGGCGCTCCCAGCCCTACAGAGGGGCGGAACCCCCGGGCGGGGCCGGCGCC TCCCCGGAGCTGCAACTGCACCCCAGGCTGCGGAGCCTCGCTGTGTGCGTCCAGGACGTCGCCCCAAACC TGCAGAGGTGCGAGCGGCTCCCCGACGGCCGCGGGACCTACCAGTGCAAGGCGAACGTCTTCCTGTCCCT GCGCGCAGCCGACTGCCTCGCCGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_148896 |
ORF Size | 378 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_148896.4, NP_683694.1 |
RefSeq Size | 721 |
RefSeq ORF | 378 |
Locus ID | 256933 |
Protein Families | Secreted Protein, Transmembrane |
Gene Summary | This gene encodes a member of the neuropeptide B/W family of proteins and preproprotein that is proteolytically processed to generate multiple protein products. The encoded products include neuropeptide B-23 and a C-terminally extended form, neuropeptide B-29, which are characterized by an N-terminal brominated tryptophan amino acid. Both of the encoded peptides bind with higher affinity to neuropeptide B/W (NPB/W) receptor 1 compared to the related NPB/W receptor 2. These peptides may regulate feeding, pain perception, and stress in rodents. [provided by RefSeq, Jul 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220796 | NPB (Myc-DDK-tagged)-Human neuropeptide B (NPB) |
USD 420.00 |
|
RG220796 | NPB (GFP-tagged) - Human neuropeptide B (NPB) |
USD 460.00 |
|
RC220796L3 | Lenti ORF clone of Human neuropeptide B (NPB), Myc-DDK-tagged |
USD 620.00 |
|
RC220796L4 | Lenti ORF clone of Human neuropeptide B (NPB), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review