DAND5 (NM_152654) Human Untagged Clone

CAT#: SC306475

DAND5 (untagged)-Human DAN domain family, member 5 (DAND5)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DAND5
• Synonyms: CER2; CERL2; CKTSF1B3; COCO; CRL2; DANTE; GREM3; SP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_152654, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTCCTTGGCCAGCTATCCACTCTTCTGTGCCTGCTTAGCGGGGCCCTGCCTACAGGCTCAGGGAGGC
  CTGAACCCCAGTCTCCTCGACCTCAGTCCTGGGCTGCAGCCAATCAGACCTGGGCTCTGGGCCCAGGGGC
  CCTGCCCCCACTGGTGCCAGCTTCTGCCCTTGGGAGCTGGAAGGCCTTCTTGGGCCTGCAGAAAGCCAGG
  CAGCTGGGGATGGGCAGGCTGCAGCGTGGGCAAGACGAGGTGGCTGCTGTGACTCTGCCGCTGAACCCTC
  AGGAAGTGATCCAGGGGATGTGTAAGGCTGTGCCCTTCGTTCAGGTGTTCTCCCGGCCCGGCTGCTCAGC
  CATACGCCTCCGAAATCATCTGTGCTTTGGTCATTGCTCCTCTCTCTACATCCCTGGCTCGGACCCCACC
  CCACTAGTCCTGTGCAACAGCTGTATGCCTGCTCGCAAGCGTTGGGCACCCGTGGTCCTGTGGTGTCTCA
  CTGGCAGCTCAGCCTCCCGTCGACGGGTGAAGATATCCACCATGCTGATCGAGGGGTGTCACTGCAGCCC
  AAAAGCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_152654
• ORF Size: 570 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_152654.2, NP_689867.1
• RefSeq Size: 1732
• RefSeq ORF: 570
• Locus ID: 199699
• Gene Summary: This gene encodes a member of the BMP (bone morphogenic protein) antagonist family. Like BMPs, BMP antagonists contain cystine knots and typically form homo- and heterodimers. The CAN (cerberus and dan) subfamily of BMP antagonists, to which this gene belongs, is characterized by a C-terminal cystine knot with an eight-membered ring. The antagonistic effect of the secreted protein encoded by this gene is likely due to its direct binding to BMP proteins. As an antagonist of BMP, this gene may play a role in regulating organogenesis, body patterning, and tissue differentiation. In mouse, this protein has been shown to bind Nodal and to inhibit the Nodal signaling pathway which patterns left/right body asymmetry. [provided by RefSeq, Jul 2008]